Difference between revisions of "Part:BBa K2983018"

Revision as of 13:49, 19 October 2019 (view source) Anthor91 (Talk | contribs) ← Older edit		Latest revision as of 18:08, 19 October 2019 (view source) TomZaplana (Talk | contribs)
(3 intermediate revisions by one other user not shown)
Line 3:		Line 3:
	<partinfo>BBa_K2983018 short</partinfo>		<partinfo>BBa_K2983018 short</partinfo>
−	This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.	+	This part is a Loop Type IIS Golden Gate adapter that contains a BsaI and a SapI restriction sites.
−		+
	===Usage and Biology===		===Usage and Biology===
		+	[[File:T--Evry Paris-Saclay--Loop-Sites.png|300px|thumb| Figure 1. BsaI and SapI restriction sites (adapted from [1])]] The Loop Type IIS cloning sites (triangles in figures 1 and 2) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figures 1 and 2).
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+	A total of 50 combinations are theoretically possible and this part is one of them: the loop A-Alpha (Figure 2).
		+
		+	[[File:T--Evry Paris-Saclay--Loop A-Alpha.png|300px|thumb|left| Figure 2. Loop A-alpha structure]]
		+
−	The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the loop A-Alpha is as fellow : GGTCTCAGGAGAATGTGAAGAGC	+	Blue triangle: SapI fixation site (GCTCTTC) on the complementary strand
−	[[File:T--Evry Paris-Saclay--Loop A-Alpha.png|300px|thumb|left| Figure 1:Loop A-alpha structure]]	+	Red triangle: BsaI fixation site (GGTCTC)
		+	Blue circle: overhang formed by SapI after cutting (GGAG)
−	Blue triangle: SapI fixation site (GCTCTTC)	+	Red circle: overhang formed by BsaI after cutting (ATG)
−	Red triangle : BsaI fixation site (GAGACC)
−	Blue circle : overhang formed by SapI after cutting (GGAG)
−	Red circle: overhang formed by BasI  after cutting  (ATG)
		+	This part was used to define the Loop assembly system dedicated to the oleaginous yeast ''Yarrowia lipolytica'' (for details visit https://2019.igem.org/Team:Evry_Paris-Saclay/Design).
		+	===References===
		+	[1] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.

---

Latest revision as of 18:08, 19 October 2019

Loop A-alpha

This part is a Loop Type IIS Golden Gate adapter that contains a BsaI and a SapI restriction sites.

Usage and Biology

The Loop Type IIS cloning sites (triangles in figures 1 and 2) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figures 1 and 2).

A total of 50 combinations are theoretically possible and this part is one of them: the loop A-Alpha (Figure 2).

Blue triangle: SapI fixation site (GCTCTTC) on the complementary strand

Red triangle: BsaI fixation site (GGTCTC)

Blue circle: overhang formed by SapI after cutting (GGAG)

Red circle: overhang formed by BsaI after cutting (ATG)

This part was used to define the Loop assembly system dedicated to the oleaginous yeast Yarrowia lipolytica (for details visit https://2019.igem.org/Team:Evry_Paris-Saclay/Design).

References

[1] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.

Sequence and Features