Difference between revisions of "Part:BBa K2951015"

 
(→‎Structure Model)
 
(9 intermediate revisions by 3 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2951015 short</partinfo>
 
<partinfo>BBa_K2951015 short</partinfo>
  
−
DNA Probe 8
 
  
−
<!-- Add more about the biology of this part here
+
<html>
 +
</p>
 +
</html>
 +
__TOC__
 +
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
This part is a ssDNA aptamer that targets the hemagglutinin of influenza A virus H3N2 (A/Perth/16/2009). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “HA3-6” due to the target protein it should recognize and our label with number during experimental process.
 +
 +
==Characterization==
 +
===Titer value===
 +
 +
The titer value of this aptamer towards its target protein hemagglutinin is determined by practicing ELISA. According to the coated protein, two important factors are tested:
 +
*Affinity-by coating target protein
 +
*Specificity-by coating un-target protein.
 +
===Non-competitive ELISA===
 +
====Method====
 +
We set up with different concentration of target protein(HA3) and non-target protein(HA1) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.
 +
*HA1: this is the abbreviation for hemagglutinin of Influenza A H1N1 (A/New York/18/2009) and it act as a non-target protein in this ELISA experiment.
 +
 +
====Result====
 +
<html>
 +
<div style="padding-left:20%">
 +
    <img src=" https://2019.igem.org/wiki/images/b/b7/T--CSMU_Taiwan--ha3-6a.jpeg" style="width:600px; text-align: center;">
 +
  <br>
 +
  <p> Fig1. There is a significant logarithmic relevance between aptamer HA3-4 and the target protein hemagglutinin. Lower value comparing with target protein shows lower relevance between HA3-6 and the non-target protein(HA1). As a result ,we found that it is actually effective to distinguish the two protein.
 +
</p>
 +
</div>
 +
</html>
 +
===Structure Model===
 +
 +
We modeled the aptamer in 2D and 3D structure as an approach to gaining insights for further optimization. Modeled results are shown in Fig2. Our conformation modeling are based on 0℃ due to the aptamer refolding process during selection was practiced at 0℃.
 +
 +
<html>
 +
<div style="padding-left:20%">
 +
    <img src="https://2019.igem.org/wiki/images/4/4c/T--CSMU_Taiwan--ha3-6b.jpeg" style="width:600px; text-align: center;">
 +
  <br>
 +
  <p> Fig2a. The sequence of HA3-6 were sent to <a href="http://unafold.rna.albany.edu/?q=mfold"> Mfold</a> server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above.
 +
Fig.2b The 3D structure of HA3-6 is predicted utilizing <a href="http://rnacomposer.cs.put.poznan.pl/ ">RNAcomposer</a> operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure.
 +
</p>
 +
</div>
 +
</html>
  
−
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K2951015 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2951015 SequenceAndFeatures</partinfo>

Latest revision as of 01:33, 22 October 2019


Apt-HA3


Usage and Biology

This part is a ssDNA aptamer that targets the hemagglutinin of influenza A virus H3N2 (A/Perth/16/2009). The sequence of this part consists of primers (forward: ATAGGAGTCACGACGACCAGAA and reverse: TATGTGCGTCTACCTCTTGACTAAT) with the unique sequence of 40bp in between. The probe can be used for direct detection stratagies such as on-site influenza detection or aptamer-based biosensors. “Apt” is the abbreviation of aptamer and this probe is named “HA3-6” due to the target protein it should recognize and our label with number during experimental process.

Characterization

Titer value

The titer value of this aptamer towards its target protein hemagglutinin is determined by practicing ELISA. According to the coated protein, two important factors are tested:

  • Affinity-by coating target protein
  • Specificity-by coating un-target protein.

Non-competitive ELISA

Method

We set up with different concentration of target protein(HA3) and non-target protein(HA1) via serial dilution and coat these protein each to a 96-well microplate. After blocking, primary antibodies were added, which is the selected aptamers in this experiment. OD value was then measured by ELISA reader at the wave length of 450nm.

  • HA1: this is the abbreviation for hemagglutinin of Influenza A H1N1 (A/New York/18/2009) and it act as a non-target protein in this ELISA experiment.

Result


Fig1. There is a significant logarithmic relevance between aptamer HA3-4 and the target protein hemagglutinin. Lower value comparing with target protein shows lower relevance between HA3-6 and the non-target protein(HA1). As a result ,we found that it is actually effective to distinguish the two protein.

Structure Model

We modeled the aptamer in 2D and 3D structure as an approach to gaining insights for further optimization. Modeled results are shown in Fig2. Our conformation modeling are based on 0℃ due to the aptamer refolding process during selection was practiced at 0℃.


Fig2a. The sequence of HA3-6 were sent to Mfold server for simulating the 2D structure of DNA and RNA at 0-100℃, and ion concentration of [Na+]=1.0,[Mg+2]=0.0. The model result is shown above. Fig.2b The 3D structure of HA3-6 is predicted utilizing RNAcomposer operated on the RNA FRABASE database and could fully automated predict the RNA 3D structure.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]