Difference between revisions of "Part:BBa K3064010"

 
(22 intermediate revisions by one other user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K3064010 short</partinfo>
 
<partinfo>BBa_K3064010 short</partinfo>
  
It is a known type of E3 ubiquitin-protein ligase as an intracellular antibody effector in the antibody-mediated proteolysis pathway.
+
Trim 21 comes from the family of TRIM. ‘MMu’ means that it is from mouse. It is a known type of E3 ubiquitin-protein ligase as an intracellular antibody effector in the antibody-mediated proteolysis pathway.
  
<!-- Add more about the biology of this part here
+
<!-- Add more about the biology of this part here -->
 
===Usage and Biology===
 
===Usage and Biology===
 +
Trim 21 has a particular domain to recognize the Fc domain and combine with antibody marked no-enveloped virions. Using its E3 ubiquitin-protein ligase activity, trim 21 with the antibody bond to virons is degraded by the Ubiquitin dependent protease degradation pathway.<Br/>
 +
 +
Due to the organism, therapeutic antibodies targeting disease-associated antigens in extracellular is a key tool for some certain diseases in current researches. Although some diseases is not caused by virons, trim 21 can be used in these diseased by blocking a particular pathogenic process.<Br/>
 +
 +
===Result===
 +
To validate the protein degradation efficiency of the ScFv-based ErbB3 Predator system, we
 +
transfected MCF7 cells with plasmids expressing ScFvErbB3-linker-Fc fusion protein and HA-
 +
Trim21. Western Blotting analysis showed that with the high expression of ScFvErbB3-linker-
 +
Fc fusion protein and HA-Trim21, the ErbB3 protein level decreased dramatically in cells
 +
transfected with ErbB3 Predator (approximately 30%, Fig 1A and B). This result demonstrated that the ScFv-based Predator system could successfully degrade the targeted membrane protein.
 +
 +
https://static.igem.org/mediawiki/parts/c/c6/T--NUDT_CHINA--erbB3-composite.jpg
 +
 +
Figure 1. (A and B) Western blotting assay showing the components of ErbB3 Predator and the degradation of ErbB3.
 +
 +
  
 
<!-- -->
 
<!-- -->
 +
===Sequence and Features===
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K3064010 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3064010 SequenceAndFeatures</partinfo>
ATGTCTCTGGAAAAGATGTGGGAGGAGGTCACCTGTTCTATCTGCCTGGATCCCATGGTGGAGCCTATGAGTATCGAATGTGGCCATTGCTTTTGCAAGGAATGCATTTTTGAAGTTGGGAAGAATGGGGGCAGTTCATGTCCCGAGTGCCGGCAACAGTTTCTGCTCCGAAACCTCAGGCCCAATAGACATATAGCCAACATGGTGGAAAACCTTAAACAGATAGCCCAGAATACCAAGAAGAGTACCCAGGAAACGCACTGCATGAAGCATGGAGAGAAGCTTCACCTATTCTGTGAGGAAGATGGGCAGGCCCTTTGCTGGGTGTGTGCCCAGTCTGGGAAACACCGGGACCACACCAGGGTCCCTATTGAAGAGGCTGCTAAGGTATACCAGGAGAAGATCCACGTGGCTTTAGAAAAACTGAGAAAGGGGAAAGAGTTGGCCGAGAAGATGGAAATGGATCTCACGATGCAAAGAACAGACTGGAAGAGGAACATTGACACCCAGAAGTCGAGGATTCACGCAGAGTTCGCACTTCAGAATAGCTTGCTGGCTCAGGAGGAGCAGAGGCAGCTGCAGAGGCTGGAGAAGGATCAAAGGGAGTACCTGAGACTCCTGGGGAAGAAGGAGGCTGAGCTGGCTGAGAAGAACCAGGCCCTGCAGGAGCTGATCTCAGAGCTGGAGAGGAGGATTCGTGGTTCAGAGCTGGAGCTACTGCAGGAGGTGAGGATCATCCTGGAAAGGAGTGGATCCTGGAACCTGGACACGTTAGATATTGACGCCCCAGACCTAACAAGCACATGCCCTGTGCCAGGGCGGAAGAAGATGCTGAGGACATGTTGGGTTCATATTACTCTGGATCGCAACACCGCCAACTCATGGCTCATCATCTCAAAGGATCGGAGACAAGTGAGGATGGGAGACACCCATCAGAACGTGTCTGACAATGAGGAGAGGTTTAGTAATTACCCCATGGTGCTAGGTGCCCAGAGATTCTCCTCTGGGAAGATGTACTGGGAGGTAGATGTGACTCAAAAGGAGGCCTGGGATCTGGGGGTTTGCAGAGATTCTGTTCAGAGGAAAGGGCAGTTTTCACTCAGTCCCGAGAATGGCTTCTGGACCATTTGGTTATGGCAAGACAGCTATGAGGCTGGTACCAGTCCTCAGACCACCCTCCACATTCAAGTACCTCCATGCCAAATTGGGATCTTTGTGGACTATGAGGCTGGCGTTGTCTCCTTCTACAACATAACTGACCATGGCTCCCTCATTTACACCTTCTCGGAGTGTGTTTTTGCTGGACCTCTGCGACCTTTCTTCAATGTTGGTTTCAATTATAGTGGGGGAAATGCAGCGCCTCTAAAGCTCTGTCCACTAAAGATGTGA
+
 
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
Line 17: Line 34:
 
<partinfo>BBa_K3064010 parameters</partinfo>
 
<partinfo>BBa_K3064010 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===References===
 +
 +
 +
 +
1.TRIM21[G/OL]. https://en.wikipedia.org/wiki/TRIM21 ,2019.
 +
 +
2.Stian Foss, Ruth Watkinson, Inger Sandlie, et al. TRIM21: a cytosolic Fc receptor with broad antibody isotype specificity[J]. Immunological Reviews, 2015, 268(1):328-339.
 +
 +
3.Lee AYS. A review of the role and clinical utility of anti-Ro52/TRIM21 in systemic autoimmunity[J]. Rheumatology International, 2017, 37(8):1323-1333.

Latest revision as of 00:08, 27 October 2020


mmuTrim21

Trim 21 comes from the family of TRIM. ‘MMu’ means that it is from mouse. It is a known type of E3 ubiquitin-protein ligase as an intracellular antibody effector in the antibody-mediated proteolysis pathway.

Usage and Biology

Trim 21 has a particular domain to recognize the Fc domain and combine with antibody marked no-enveloped virions. Using its E3 ubiquitin-protein ligase activity, trim 21 with the antibody bond to virons is degraded by the Ubiquitin dependent protease degradation pathway.

Due to the organism, therapeutic antibodies targeting disease-associated antigens in extracellular is a key tool for some certain diseases in current researches. Although some diseases is not caused by virons, trim 21 can be used in these diseased by blocking a particular pathogenic process.

Result

To validate the protein degradation efficiency of the ScFv-based ErbB3 Predator system, we transfected MCF7 cells with plasmids expressing ScFvErbB3-linker-Fc fusion protein and HA- Trim21. Western Blotting analysis showed that with the high expression of ScFvErbB3-linker- Fc fusion protein and HA-Trim21, the ErbB3 protein level decreased dramatically in cells transfected with ErbB3 Predator (approximately 30%, Fig 1A and B). This result demonstrated that the ScFv-based Predator system could successfully degrade the targeted membrane protein.

T--NUDT_CHINA--erbB3-composite.jpg

Figure 1. (A and B) Western blotting assay showing the components of ErbB3 Predator and the degradation of ErbB3.


Sequence and Features

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 75
    Illegal BamHI site found at 778
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 176
  • 1000
    COMPATIBLE WITH RFC[1000]


References

1.TRIM21[G/OL]. https://en.wikipedia.org/wiki/TRIM21 ,2019.

2.Stian Foss, Ruth Watkinson, Inger Sandlie, et al. TRIM21: a cytosolic Fc receptor with broad antibody isotype specificity[J]. Immunological Reviews, 2015, 268(1):328-339.

3.Lee AYS. A review of the role and clinical utility of anti-Ro52/TRIM21 in systemic autoimmunity[J]. Rheumatology International, 2017, 37(8):1323-1333.