Difference between revisions of "Part:BBa J45503:Experience"

No review score entered. Username

The 2005 UCSF iGEM team remarks, "By far, the best promoter is hybB, which controlls the hydrogenase II operon. It is clearly active at temperatures lower than 30oC and is off at temperatures higher than 30oC."

[http://2011.igem.org/Team:KULeuven K.U.Leuven iGEM 2011 Team]

Motivation of this Design/Usage - K.U.Leuven 2011 iGEM Team

This part was designed to test the functionality of the promotor region. We cloned the HybB promoter via PCR using the K410000 as a template using the primers below -

hyb-FW: CCGGAATTCGCGGCCGCTTCTAGAGCGCCGCTATGGACTGGATAAAG

hyb-RV: AAAACTGCAGCGGCCGCTACTAGTATGCTACTTAACCCCATGGTGG

Characterization by K.U.Leuven 2011 iGEM Team

To test the usefulness of the cold shock-inducible promoter J45503 in our 2011 iGEM project, we fused the promoter to a GFP reporter, and assayed the promoter’s activity after a temperature shift from 37°C to 25°C or 4°C. We tested this activity both in a TOP10F’ (figure 1) as well as a MG1655 (figure 2) E.coli strain background. For more information on E.coli strain descriptions, we recommend the following web site: [http://openwetware.org/wiki/E._coli_genotypes E.Coli_Genotypes].

Figure1

Figure2

We can see clearly that transferring cells (both TOP10F’ and MG1655) to lower temperatures (4°C and even 25°C) results in a growth arrest between the 1 and 4 hour time points of our experiment (Figures 1A and 2A). We see that promoter activity is induced when cells are transferred to 25°C and even when they are put in and ice bath (4°C) (Figures 1B and 2B). Unfortunately, however, cells that are kept at 37°C also display an increase in promoter activity, indicating leakiness in the system.

[http://2011.igem.org/Team:Groningen 2011 iGEM team Groningen]

After cloning the construct designed to measure the promoter activity (BBa_K607039), we have encountered problems while trying to activate it. Previous teams claim that the part is functional and it is active in temperatures below 30 degrees. This was not our experience. The construct, despite having proper sequence and being present in the cells during the measurements (done in presence of antibiotic), did not show any activity neither in low temperature nor in anaerobic conditions, which should also activate it ([http://www.ncbi.nlm.nih.gov/pubmed/10537212?dopt=Abstract Richard DJ, 1999]). After obtaining the negative results, we have also tested two other strains: BW25113 and TOP10. In neither of them the promoter was active.

The measurements were done in DH5alpha strain carrying a pSB1C3 with BBa_K607039 in triplicate.

• 

  Figure 1. Fluorescence intensity measured in DH5alpha cells carrying a pSB1C3 plasmid with BBa_K607039 construct, growing at 27 degrees.

• 

  Figure 2. Fluorescence intensity measured in BW25113 cells carrying a pSB1C3 plasmid with BBa_K607039 construct, growing at 27 degrees.

• 

  Figure 3. Fluorescence intensity measured in TOP10 cells carrying a pSB1C3 plasmid with BBa_K607039 construct, growing at 27 degrees.

• 

  Figure 4. Fluorescence intensity measured in DH5alpha cells carrying a pSB1C3 plasmid with BBa_K607039 construct, growing at 37 degrees without oxygen.

• 

  Figure 5. Fluorescence intensity measured in wild-type cells, growing at 27 degrees.

We believe that the problems with the promoter might be a result of a wrong sequence listed in the Parts Registry. [http://ecocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=TU00289 Ecocyc.org entry] shows that the promoter is much shorter than the version listed in the Parts Registry. Utilizing the proper, shorter sequence might cause that it will be possible to activate the promoter.

iGEM Hamburg 2018

When we started planning our project, we were looking for a cold shock inducible promotor, but learned that the existing one did not work properly. Therefore, we figured out that the original HybB construct was too long. Besides containing a 5´UTR, it also included a part of a coding sequence from the original downstream gene. Because we were sure that this would lead to an interference with any gene of interest which would be cloned downstream of this promotor, we shortened the original sequence and named it oHybB (optimized HybB). For further information see our Improve page.

To characterize the function of oHybB, we generated a composite part consisting of pSB1C3-oHybB-E0840. A direct comparison between our new part oHybB (BBa_K2588001) and the original HybB (BBa_J45503) was made. The activity of our promotor was characterized via measurement of the fluorescence at different temperatures (16 °C, RT and 37 °C). As a negative control, untransformed DH5α were chosen and as a positive control DH5α with pSB1C3-BBa_I20270.

Fig. 1: Improvement of BBa_K2588001 over BBa_J45503. GFP fluorescence of E. coli cultures expressing both HybB-Promoter/GFP combinations at different temperatures was measured. Values are mean + SD from three technical replicates. Significances: * corresponds to p<0.05, ** corresponds to p<0.01, *** corresponds to p<0.001.

A successful improvement of the original promotor BBa_J45503 could have been showen. In comparison, oHybB showed an increased activity after a cold shock for 13 h. The highest activity was observed at 16 °C, the lowest at 37 °C. In contrast to the original oHybB promotor our data was significant. For further information see our Improve page.