Difference between revisions of "Part:BBa K2591011"
(→‎Usage and Biology)
 
(17 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2591011 short</partinfo>
 
<partinfo>BBa_K2591011 short</partinfo>
  
−
BBa_K2591000
 
  
 
===Usage and Biology===
 
===Usage and Biology===
 +
Naturally, single guide RNA(sgRNA) is a small RNA which guides CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, <i>Nat. Protoc.</i>, 2013) 
 +
 +
 +
<div style="zoom:25%">
 +
<center>
 +
https://static.igem.org/mediawiki/2018/f/f6/T--SUSTech_Shenzhen--Silver_part_in_Wiki_page_P1_%EF%BC%86_%E9%93%B6%E7%89%8CBBa_K259101_P1.png
 +
</center>
 +
</div>
 +
<center>
 +
Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, <i>Nat. Protoc.</i>, 2013) 
 +
</center>
 +
In our project, we design a gRNA for wntless WNT ligand secretion mediator (Wls), which is a functional protein for the secretion of the Wnt3A protein and assist the modification for the mature Wnt3A protein. Therefore, if we transfect the gRNA of Wls into cells, we can inhibit the donor cell to secret the Wnt3A protein normally. And we have integrated this gRNA together with its scaffold into the backbone pSB1C3 to get a new part.(Fig2)
 +
<div style="zoom:25%">
 +
<center>
 +
https://static.igem.org/mediawiki/2018/0/0d/T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P2.png
 +
</center>
 +
</div>
 +
<center>
 +
Figure2. Diagram of pSB1C3_gRNA_scaffold.
 +
</center>
  
 
===Characterization===
 
===Characterization===
  
 +
length: 20 nt
 +
 +
target sequence: TGACAAGATCCGTGACATCG
 +
 +
primer for plasmid construction:
 +
 +
Wls-gRNA-F 5' -CACCGTGACAAGATCCGTGACATCG- 3'
 +
 +
Wls-gRNA-R 5' -AAACCGATGTCACGGATCTTGTCAC- 3'
 +
 +
location in gene loci:
 +
 +
<div style="zoom:25%">
 +
<center>
 +
https://static.igem.org/mediawiki/2018/0/08/T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P3.png
 +
</center>
 +
</div>
 +
<center>
 +
Figure 3. the gRNA is designed to target a conserved exon of Wls of mouse (From NCBI)
 +
</center>
 +
 +
As mentioned above, knockout of PORCN will impair the Wnt3a secretion activity in the cells. Therefore, we first introduced sgPor into L-Wnt3A-Cas9-mCherry cell line, which continuously expressed Cas9 protein. And then, this donor cell line was cocultured with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence  to validate our part one day later. We also observed the validated results using FACS. Validation images are shown in Fig4 and Fig5.   
 +
 +
<div style="zoom:25%">
 +
<center>
 +
https://static.igem.org/mediawiki/2018/a/a3/T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P4.png
 +
</center>
 +
</div>
 +
<center>
 +
Figure4. Knockout of WLS show no wnt secretion, fluorescence validation. First row: normal 293R cell line. Second row: 293R cell line cultured with L-cell with WLS knockout. Third row: 293R cell line cultured with L-cell with no target knockout. Column legends indicated the observation field, merged means artificial adding of red and green. We cannot see green fluorescent protein at the green filed(475nm), it means the Wnt3A protein cannot be secreted from the L cell normally, and the gRNA designed for WLS could target specific sequence and did mutate it with Cas9 protein.
 +
</center>
 +
 +
<div style="zoom:25%">
 +
<center>
 +
https://static.igem.org/mediawiki/2018/c/c4/T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P5.png
 +
</center>
 +
</div>
 +
<center>
 +
Figure5. Knockout of WLS show no wnt secretion, FACS validation. (a) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 24 hours. (b) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 0 hours. (c) Coculture of L cell-WLS-KO with 293R-TCF-GFP in 24 hours.
 +
</center>
 +
 +
===Reference===
 +
<p style="text-indent: 36pt;"><span style="font-size: 10pt; font-family: &quot;Calibri&quot;,&quot;sans-serif&quot;;" lang="EN-US">Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system.  <i>Nature protocols,</i> 8(11), 2281.</span></p>
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>

Latest revision as of 10:13, 17 October 2018


gWls-scaffold


Usage and Biology

Naturally, single guide RNA(sgRNA) is a small RNA which guides CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013)


T--SUSTech_Shenzhen--Silver_part_in_Wiki_page_P1_%EF%BC%86_%E9%93%B6%E7%89%8CBBa_K259101_P1.png

Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013)

In our project, we design a gRNA for wntless WNT ligand secretion mediator (Wls), which is a functional protein for the secretion of the Wnt3A protein and assist the modification for the mature Wnt3A protein. Therefore, if we transfect the gRNA of Wls into cells, we can inhibit the donor cell to secret the Wnt3A protein normally. And we have integrated this gRNA together with its scaffold into the backbone pSB1C3 to get a new part.(Fig2)

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P2.png

Figure2. Diagram of pSB1C3_gRNA_scaffold.

Characterization

length: 20 nt

target sequence: TGACAAGATCCGTGACATCG

primer for plasmid construction:

Wls-gRNA-F 5' -CACCGTGACAAGATCCGTGACATCG- 3'

Wls-gRNA-R 5' -AAACCGATGTCACGGATCTTGTCAC- 3'

location in gene loci:

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P3.png

Figure 3. the gRNA is designed to target a conserved exon of Wls of mouse (From NCBI)

As mentioned above, knockout of PORCN will impair the Wnt3a secretion activity in the cells. Therefore, we first introduced sgPor into L-Wnt3A-Cas9-mCherry cell line, which continuously expressed Cas9 protein. And then, this donor cell line was cocultured with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence to validate our part one day later. We also observed the validated results using FACS. Validation images are shown in Fig4 and Fig5.

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P4.png

Figure4. Knockout of WLS show no wnt secretion, fluorescence validation. First row: normal 293R cell line. Second row: 293R cell line cultured with L-cell with WLS knockout. Third row: 293R cell line cultured with L-cell with no target knockout. Column legends indicated the observation field, merged means artificial adding of red and green. We cannot see green fluorescent protein at the green filed(475nm), it means the Wnt3A protein cannot be secreted from the L cell normally, and the gRNA designed for WLS could target specific sequence and did mutate it with Cas9 protein.

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591011_P5.png

Figure5. Knockout of WLS show no wnt secretion, FACS validation. (a) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 24 hours. (b) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 0 hours. (c) Coculture of L cell-WLS-KO with 293R-TCF-GFP in 24 hours.

Reference

Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system.  Nature protocols, 8(11), 2281.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]