Difference between revisions of "Part:BBa K2668070"
(3 intermediate revisions by 2 users not shown) | |||
Line 9: | Line 9: | ||
<h2>Introduction</h2> | <h2>Introduction</h2> | ||
− | <p>The part BBa_K2668070 was used to validate the | + | <p>The part BBa_K2668070 was used to validate the streptavidin head of the Cerberus platform (</html><partinfo>BBa_K2668010</partinfo><html>). </p> |
<h2>Construction</h2> | <h2>Construction</h2> | ||
− | <p>The part BBa_K2668070 | + | <p>The part BBa_K2668070 corresponds to a genetic sequence encoding the mTag Blue Fluorescent Protein fused with an AviTag. IDT performed the DNA synthesis and delivered the part as gBlock. The construct was cloned by In-fusion into the pSB1C3 plasmid with the below primers and then transformed into <i>E. coli</i> Dh5-alpha strain. Figure 1 shows the restriction map of the resulting clones. We expected two bands at 700bp. All the clones show the expected restriction profiles. The clones 2 was deposited in the registry of Standard Biological Parts.</p> |
+ | <p>Primers used for cloning into pETDuet-1: (5' -> 3')</p> | ||
+ | <ul> | ||
+ | <li>BFP_pET_Forward : ACCACAGCCAGGATCCTATGAGCGAACTGATCAAAGAGAACA</li> | ||
+ | <li>BFP_pET_Reverse : ATGCGGCCGCAAGCTTCTCATGCCATTCAATTTTCTGTGCT</li> | ||
+ | </ul> | ||
+ | <p>Primers used for cloning into pSB1C3: (5' -> 3')</p> | ||
+ | <ul> | ||
+ | <li>BFP_pSB1C3_Forward : CGCGGCCGCTTCTAGAATGAGCGAACTGATCAAAGAGAACA</li> | ||
+ | <li>BFP_pSB1C3_Reverse : AGCGGCCGCTACTAGTCTCATGCCATTCAATTTTCTGTGCT</li> | ||
+ | </ul> | ||
<div class="center"> | <div class="center"> | ||
<div class="thumb tnone"> | <div class="thumb tnone"> | ||
<div class="thumbinner" style="width:362px;"> | <div class="thumbinner" style="width:362px;"> | ||
<a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPaviAgar.png" class="image"> | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPaviAgar.png" class="image"> | ||
− | <img alt="" src="/wiki/images/d/dc/T--Toulouse-INSA-UPS--Registry--Youn--BFPaviAgar.png" width="360" height= | + | <img alt="" src="/wiki/images/d/dc/T--Toulouse-INSA-UPS--Registry--Youn--BFPaviAgar.png" width="360" height=auto class="thumbimage" /></a> <div class="thumbcaption"> |
<div class="magnify"> | <div class="magnify"> | ||
<a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPaviAgar.png" class="internal" title="Enlarge"></a> | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPaviAgar.png" class="internal" title="Enlarge"></a> | ||
Line 26: | Line 36: | ||
</div> | </div> | ||
</div> | </div> | ||
− | <h2> | + | <h2>Characterization</h2> |
− | <p>The part BBa_K2668070 was used to assess the ability of Orthos to functionalize cellulose with a compound biotinylated in vivo. Indeed, proteins containing the AviTag small peptide can be efficiently biotinylated | + | <p>The part BBa_K2668070 was used to assess the ability of a chimeric fusion between the cellulose binding domain CBM3a and a monomeric streptavidin head mSA2 (a construction we nicknamed Orthos ; see part </html><partinfo>BBa_K2668010</partinfo><html>) to functionalize cellulose with a compound biotinylated <em>in vivo</em>. Indeed, proteins containing the AviTag small peptide can be efficiently biotinylated <i>in vivo</i> by BirA. BirA is the <em>E. coli</em> biotin ligase that has high affinity toward AviTag. The part BBa_K2668070 was subcloned into the pETDuet-1 expression vector where BirA was previously cloned and transformed into <em>E. coli</em> strain BL21. Biotin was added in the culture medium (0.1 mM final concentration) during IPTG induction in order to produce biotinylated BFP. Next, 3.2 µM of Orthos were incubated with 32 µM of <i>in vivo</i> biotinylated BFP. For the control experiment, the same quantity of BFP was incubated without Orthos. These samples were finally incubated with cellulose. After several washes with resuspension buffer, fluorescence was measured in the cellulose pellets. As shown in Figure 2, fluorescence is two time higher in the sample containing Orthos than in the sample than in the control sample.</p> |
<div class="center"> | <div class="center"> | ||
<div class="thumb tnone"> | <div class="thumb tnone"> | ||
<div class="thumbinner" style="width:362px;"> | <div class="thumbinner" style="width:362px;"> | ||
<a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPValid.png" class="image"> | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPValid.png" class="image"> | ||
− | <img alt="" src="/wiki/images/3/35/T--Toulouse-INSA-UPS--Registry--Youn--BFPValid.png" width="360" height= | + | <img alt="" src="/wiki/images/3/35/T--Toulouse-INSA-UPS--Registry--Youn--BFPValid.png" width="360" height=auto class="thumbimage" /></a> <div class="thumbcaption"> |
<div class="magnify"> | <div class="magnify"> | ||
<a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPValid.png" class="internal" title="Enlarge"></a> | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--BFPValid.png" class="internal" title="Enlarge"></a> | ||
Line 43: | Line 53: | ||
</div> | </div> | ||
− | <p>These results demonstrate that | + | <p>These results demonstrate that the mTagBFP blue fluorescent protein was well-tagged with biotine which validates the part. In addition, they show that Orthos binds to cellulose and thus provide a proof of principle that Orthos design allows functionalization of cellulose with a fluorophore through its streptavidin linker.</p> |
</html> | </html> |
Latest revision as of 21:53, 16 October 2018
mTagBFP AviTag
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Introduction
The part BBa_K2668070 was used to validate the streptavidin head of the Cerberus platform (BBa_K2668010).
Construction
The part BBa_K2668070 corresponds to a genetic sequence encoding the mTag Blue Fluorescent Protein fused with an AviTag. IDT performed the DNA synthesis and delivered the part as gBlock. The construct was cloned by In-fusion into the pSB1C3 plasmid with the below primers and then transformed into E. coli Dh5-alpha strain. Figure 1 shows the restriction map of the resulting clones. We expected two bands at 700bp. All the clones show the expected restriction profiles. The clones 2 was deposited in the registry of Standard Biological Parts.
Primers used for cloning into pETDuet-1: (5' -> 3')
- BFP_pET_Forward : ACCACAGCCAGGATCCTATGAGCGAACTGATCAAAGAGAACA
- BFP_pET_Reverse : ATGCGGCCGCAAGCTTCTCATGCCATTCAATTTTCTGTGCT
Primers used for cloning into pSB1C3: (5' -> 3')
- BFP_pSB1C3_Forward : CGCGGCCGCTTCTAGAATGAGCGAACTGATCAAAGAGAACA
- BFP_pSB1C3_Reverse : AGCGGCCGCTACTAGTCTCATGCCATTCAATTTTCTGTGCT
Characterization
The part BBa_K2668070 was used to assess the ability of a chimeric fusion between the cellulose binding domain CBM3a and a monomeric streptavidin head mSA2 (a construction we nicknamed Orthos ; see part BBa_K2668010) to functionalize cellulose with a compound biotinylated in vivo. Indeed, proteins containing the AviTag small peptide can be efficiently biotinylated in vivo by BirA. BirA is the E. coli biotin ligase that has high affinity toward AviTag. The part BBa_K2668070 was subcloned into the pETDuet-1 expression vector where BirA was previously cloned and transformed into E. coli strain BL21. Biotin was added in the culture medium (0.1 mM final concentration) during IPTG induction in order to produce biotinylated BFP. Next, 3.2 µM of Orthos were incubated with 32 µM of in vivo biotinylated BFP. For the control experiment, the same quantity of BFP was incubated without Orthos. These samples were finally incubated with cellulose. After several washes with resuspension buffer, fluorescence was measured in the cellulose pellets. As shown in Figure 2, fluorescence is two time higher in the sample containing Orthos than in the sample than in the control sample.
These results demonstrate that the mTagBFP blue fluorescent protein was well-tagged with biotine which validates the part. In addition, they show that Orthos binds to cellulose and thus provide a proof of principle that Orthos design allows functionalization of cellulose with a fluorophore through its streptavidin linker.