Difference between revisions of "Part:BBa K2834004"

 
(10 intermediate revisions by one other user not shown)
Line 5: Line 5:
 
<p align="justify">
 
<p align="justify">
 
Expressible defensin 2 antimicrobial peptide from Apis mellifera  
 
Expressible defensin 2 antimicrobial peptide from Apis mellifera  
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, Defensin 2 honey bee antimicrobial peptide, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of [péptido] in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
+
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, defensin 2 honey bee antimicrobial peptide, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of [péptido] in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
  
 +
</p>
 +
 +
<br>
 +
<p align="justify">
 +
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:<br>
 +
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCA TGAAGTTCTTTGTACTTTTTGCGATTCTCATTGCTATCGTTCACGCATCTTGCGCAAGTGTTCCTAAAGTTGTTTACGATGGACCGATTTACGAGTTGAGGCAAA TTGAGGAGGAAAATATAGAACCAGATACAGAATTGATGGATTCCAACGAACCGCTGCTACCACTACGACATCGAAGGGTAACGTGCGACGTTTTATCATGGCAAT CAAAATGGCTGAGCATTAATCATTCAGCTTGCGCTATCAGATGTTTAGCTCAACGACGTAAAGGCGGTAGTTGCAGAAATGGCGTGTGTATCTGTCGAAAGCATC ACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC
 +
 
</p>
 
</p>
  

Latest revision as of 01:58, 18 October 2018

Expressible defensin 2 antimicrobial peptide from Apis mellifera


Expressible defensin 2 antimicrobial peptide from Apis mellifera This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, defensin 2 honey bee antimicrobial peptide, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of [péptido] in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.


As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCA TGAAGTTCTTTGTACTTTTTGCGATTCTCATTGCTATCGTTCACGCATCTTGCGCAAGTGTTCCTAAAGTTGTTTACGATGGACCGATTTACGAGTTGAGGCAAA TTGAGGAGGAAAATATAGAACCAGATACAGAATTGATGGATTCCAACGAACCGCTGCTACCACTACGACATCGAAGGGTAACGTGCGACGTTTTATCATGGCAAT CAAAATGGCTGAGCATTAATCATTCAGCTTGCGCTATCAGATGTTTAGCTCAACGACGTAAAGGCGGTAGTTGCAGAAATGGCGTGTGTATCTGTCGAAAGCATC ACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 86
  • 1000
    COMPATIBLE WITH RFC[1000]