Difference between revisions of "Part:BBa K1592002:Experience"

(mutation is successfuly)
(User Reviews)
 
Line 19: Line 19:
 
<!-- End of the user review template -->
 
<!-- End of the user review template -->
 
<!-- DON'T DELETE --><partinfo>BBa_K1592002 EndReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_K1592002 EndReviews</partinfo>
//In this part, we would like to realize a point mutation. Totally, this sequence includes 2436bp. So we decided to use PCR to mutate. Mutation site locates at 2238 within BBa_K1592002, C->T.Primer forward is cgaggccgctgctggtgctcacgccactgccggtgccattg,and reverse is caatggcaccggcagtggcgtgagcaccagcagcggcctcg.
+
//
Mix include: BM2 2 μl, forward primer 2μl, reverse primer 2μl, H2O 19μ, 2×phanta Max Master Mix25μl.Process includes 95°C for 30s, degradation at 95°C for 15s,annealing at 63°C for 15s, extension at 72°C for 2min, 25cycles,72°C for another 5min.Then run a gel to see whether PCR is successful. Use 5k marker and 1% gel running for 30min. After that, extract DNA sample from gel to get final products. But we cannot make sure whether point mutation happened. So we sent sample to a sequencing company. Fortunately, it’s mutated.
+
iGEM18_SUSTech_Shenzhen further characterized this part by repair the point mutation.

Latest revision as of 07:56, 13 October 2018


This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1592002

User Reviews

UNIQ865a0d6aa084f7c0-partinfo-00000000-QINU UNIQ865a0d6aa084f7c0-partinfo-00000001-QINU // iGEM18_SUSTech_Shenzhen further characterized this part by repair the point mutation.