Difference between revisions of "Part:BBa K2591014:Design"
(→Source) |
(→Design Notes) |
||
(3 intermediate revisions by the same user not shown) | |||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
− | |||
− | We used primers TCF_GFP_1st_F(gtaagatcaaaggtgtagagggtatataatggatccgg) and TCF_GFP_1st_R(tcctagcagaagcacagggtgcagg) to amplify the GFP part, add TATA box and remove the PstI digestion site in GFP. And then we did an extension PCR with primers TCF_GFP_2nd_F(ATTCGCGGCCGCTTCTAGAGgatcaaagggggtaagatcaaaggtgtagaggg) and TCF_GFP_2nd_R(TGCAGCGGCCGCTACTAGTActacacattgatcctagcagaagcacag) to add the prefix and suffix. At the same time, we used primers suffix_F(TACTAGTAGCGGCCGCTGCAG) and prefix_R(CTCTAGAAGCGGCCGCGAATTC) to do a reverse PCR for pSB1C3 backbone. Finally, we ligated the PCR linearized pSB1C3 and GFP part fragment by Gibson Assembly. | + | We used primers TCF_GFP_1st_F(5'-gtaagatcaaaggtgtagagggtatataatggatccgg-3') and TCF_GFP_1st_R(5'-tcctagcagaagcacagggtgcagg-3') to amplify the GFP part, add TATA box and remove the PstI digestion site in GFP. And then we did an extension PCR with primers TCF_GFP_2nd_F(5'-ATTCGCGGCCGCTTCTAGAGgatcaaagggggtaagatcaaaggtgtagaggg-3') and TCF_GFP_2nd_R(5'-TGCAGCGGCCGCTACTAGTActacacattgatcctagcagaagcacag-3') to add the prefix and suffix. At the same time, we used primers suffix_F(5'-TACTAGTAGCGGCCGCTGCAG-3') and prefix_R(5'-CTCTAGAAGCGGCCGCGAATTC-3') to do a reverse PCR for pSB1C3 backbone. Finally, we ligated the PCR linearized pSB1C3 and GFP part fragment by Gibson Assembly. |
===Source=== | ===Source=== | ||
− | |||
− | |||
TCF and TATA box are both from synthesis, because they are known sequence and relatively short. GFP sequence is from our host lab. | TCF and TATA box are both from synthesis, because they are known sequence and relatively short. GFP sequence is from our host lab. | ||
===References=== | ===References=== | ||
+ | |||
+ | Blauwkamp, T.A. et al. Endogenous Wnt signalling in human embryonic stem cells generates an equilibrium of distinct lineage-specified progenitors. Nat. Commun. 3:1070 doi: 10.1038/ncomms2064 (2012) |
Latest revision as of 07:34, 7 October 2018
TCF-TATA-GFP
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 56
Illegal BamHI site found at 42
Illegal XhoI site found at 52 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 120
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
We used primers TCF_GFP_1st_F(5'-gtaagatcaaaggtgtagagggtatataatggatccgg-3') and TCF_GFP_1st_R(5'-tcctagcagaagcacagggtgcagg-3') to amplify the GFP part, add TATA box and remove the PstI digestion site in GFP. And then we did an extension PCR with primers TCF_GFP_2nd_F(5'-ATTCGCGGCCGCTTCTAGAGgatcaaagggggtaagatcaaaggtgtagaggg-3') and TCF_GFP_2nd_R(5'-TGCAGCGGCCGCTACTAGTActacacattgatcctagcagaagcacag-3') to add the prefix and suffix. At the same time, we used primers suffix_F(5'-TACTAGTAGCGGCCGCTGCAG-3') and prefix_R(5'-CTCTAGAAGCGGCCGCGAATTC-3') to do a reverse PCR for pSB1C3 backbone. Finally, we ligated the PCR linearized pSB1C3 and GFP part fragment by Gibson Assembly.
Source
TCF and TATA box are both from synthesis, because they are known sequence and relatively short. GFP sequence is from our host lab.
References
Blauwkamp, T.A. et al. Endogenous Wnt signalling in human embryonic stem cells generates an equilibrium of distinct lineage-specified progenitors. Nat. Commun. 3:1070 doi: 10.1038/ncomms2064 (2012)