Latest revision as of 02:40, 28 October 2020

tet-ON promoter

Biology and Usage

Tet-ON promoter is the promoter sequence in the Tet-inducible transcription system (tet-ON system).

Tet-ON system (Gossen et al., 1995) is a inducible transcription system widely used in mammalian cells. The tet-ON system utilizes the sequence-specific DNA binding property of tet repressor protein (tetR) from Escherichia coli in the presence of tet or dox, and consists of two parts: The Tet-inducible CMV promoter (tet-ON promoter) and reverse tetracycline-controlled transactivator (rtTA). The tet-ON promoter consists of tandem tetracycline-responsive elements (TRE) followed by a minimal CMV promoter. The rtTA protein comprises of reverse-tetR (rtetR, mutant of tetR) and activation domains from herpes simplex virus VP16. When tet or dox is added, the rtTA binds to TRE, and VP16 domain will recruit factors of RNA polymerase II to initiate transcription. In the absence of tet or dox, the rtTA detaches from tetON promoter, and thus no transcription.

Design Considerations

The nucleotide sequence was obtained from our host lab. Biobrick prefix and suffix was added by PCR using the following primers,

tetON-prefix: 5’ cggaattcgcggccgcttctagagtttggactaggatcctttaccactc 3’

tetON-suffix: 5’ AActgcagcggccgctactagtaagctctgcttatataggcctcc 3’

and ligated onto the pSB1C3 plasmid backbone obtained from digestion of pSB1C3-lacI-RFP(Part:BBa_J04450). The sequence was comfirmed by Sanger sequencing by IGE Biotechnology LTD using VF2 as the forward primer.

Note that this promoter has basal leaky transcription

Also note that this promoter needs to be used in stable cell lines expressing rtTA or in cells co-transfected with expression vector for rtTA.

Improvement on a previous part

In iGEM 2010, the team LMU-Munich submitted a basic part Part:BBa_K368001 called minimal CMV Promoter with TRE (tet responsible element). While it is almost identical in composition to our part, little data was provided. We decided to improve the part by submitting the promoter sequence used in our project for teams in the future. We also characterized the promoter function using both fluorescence imaging and western blot, obtaining results on optimal induction concentration and the time course of expression. We believed the data from our experiments may benefit teams in the future. In addition, the original part was used in stable cell lines, which is not available to all teams around the world. By additionally submitting a coding sequence of reverse tet-responsive transactivator Part:BBa_K2748001 to the registry, we aims to benefit the community that teams in the future can establish their own stable cell lines for for tet-inducible expression, or integrate it into vectors containing tet-ON promoter (like we did!) for tet-inducible expression of gene of interest.

Characterization

For more details, please check out our [http://2018.igem.org/Team:SYSU-CHINA#/Demonstrate result page]!

In iGEM 2018, SYSU-CHINA attempted to develop a reversible safe switch for CAR T therapy based on the tet-inducible CMV promoter and U24 protein of Human Herpesvirus 6. Since it is the major part of our project, we conducted extensive research on U24 and obtained valuable results..

In order to determine the optimal concentration of dox for induction, equal amount of HEK293T cells were seeded in 6-well plates and transfected with ptetON-GFP-T2A-U24. Different concentration of dox was added to each well immediately after transfection. For comparison, pEF1a-GFP-T2A-U24 was used as a positive control. 3 fluorescence images of each well were captured and analyzed with ImageJ for fluorescence intensity 24h after introduction of dox. And equal amount of cells were harvested for western blots analysis.

In the absence of Dox, the transient transfected cells exhibited low level of fluorescence, the fluorescence intensity increased as the concentration increase and reached a plateau. In agreement with the fluorescence data, the result from western blot analysis also indicated a rapid increase on expression level at low level of dox and soon reached a plateau after the concentration exceeded 100ng/ml. Thus we reasoned that 100ng/ml is the lowest concentration needed for optimal induction. However, the basal expression level was high, since only 3-fold increase at optimal condition compared to no induction.

Figure 2: Fluorescence and western blot analysis of U24 expression under different concentration of doxycycline

In order to determine the expression time course after adding dox, equal amount of HEK293T cells were seeded in a 6-well plate and transfected with ptetON-GFP-T2A-U24. Dox was added at the same time in all wells and equal number of cells in each well were harvested at the indicated time for western blot analysis. The result was analyzed with ImageJ and the amount of protein of interest was normalized using β-actin as internal controls.

We observed an increase of HA-tagged protein level over the time of 24h and reached a plateau at around 6h, confirming a relatively fast response. However, the fold change was small that a less than 2-fold change was observed, indicating insufficient induction. Due to the time limits, we were unable to conduct additional experiments and more repeats are needed to further validate the results.

Figure 3: Time course of U24 expression

2020 SYSU-CHINA's characterization

We added some quantitative experimental characterization data on the Tet-On System.
In order to know how many DOX our system needs to work effectively, we do an experiment about the relation between the concentration of DOX and gene expression.

And we use a STEM-LOOP effectively reduce the local expression of pTRE.

References

Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., and Bujard, H. (1995). Transcriptional activation by tetracyclines in mammalian cells. Science 268, 1766-1769.

Sequence and Features