Difference between revisions of "Part:BBa I715052:Design"

Latest revision as of 18:35, 11 June 2008

Trp Leader Peptide and anti-terminator/terminator

Design Notes

Anti-terminators occur in nature to regulate transcription of a variety of genes, such as bacterial operons and phage genes (Nudler et al., 2002). Transcriptional termination is caused by the formation of an RNA stem-loop structure, the terminator, that forces RNA polymerase to detach from the mRNA. An anti-terminator is another RNA stem-loop structure that precedes and inhibits the formation of the terminator and its stem-loop structure, thereby preventing termination (Nudler et al., 2002). Although the anti-terminator is also a stem-loop structure, it does not terminate transcription. If an anti-terminator forms, a terminator cannot form, and transcription continues. This transcriptional attenuation mechanism allows for regulation of transcription by either selectively terminating transcription prematurely or by allowing it to proceed. The choice between transcriptional termination or anti-termination will change what is transcribed and modify gene regulation in response to environmental conditions.
Let’s look at a specific example to illustrate more clearly how anti-terminators work. The tryptophan operon in E. coli, trp, is regulated using an anti-terminator and encodes for genes that synthesize the amino acid tryptophan. The first important step in the transcription of the operon takes place at the leader peptide sequence, trpL. In bacteria, translation can begin while transcription is still under way. In this particular case, it is critical that transcription and translation are synchronized, such that a specific distance between the RNA polymerase and ribosome is set. RNA polymerase begins transcribing the mRNA until it produces a stem-loop structure which causes the polymerase to pause, denoted by the yellow region. The pause by RNA polymerase gives the ribosome time to start translating the trpL mRNA sequence into a short, non-functional leader peptide and to catch up with RNA polymerase. Once the ribosome has caught up to the RNA polymerase, the secondary structure that caused the RNA polymerase to pause is altered, and RNA polymerase continues transcription. This pausing of RNA polymerase causes transcription and translation to become coupled and to happen in synchrony (Landick et al., 1987).
Before the leader peptide’s stop codon, and near the beginning of the anti-terminator sequence, are two sequential codons that code for tryptophan, shown in orange. If tryptophan concentrations are low, the ribosome will pause at these two tryptophan codons until tRNAs carrying tryptophan arrive. Meanwhile, RNA polymerase moves further downstream, elongating the mRNA molecule. The elongated mRNA forms an anti-terminator stem-loop structure which prevents the formation of a terminator stem-loop. The RNA polymerase continues mRNA elongation, the ribosome resumes once two tRNATrp arrive and the entire trp operon is transcribed and translated (Landick et al., 1987). Conversely, when tryptophan is abundant, the ribosome does not pause at the pair of tryptophan codons because tRNATrp are plentiful; translation continues unabated, and RNA polymerase does not distance itself from the ribosome. As the ribosome advances, it prevents the formation of the anti-terminator stem-loop structure through steric interactions. The lack of an anti-terminator structure leads to the formation of a new stem-loop structure, the transcriptional terminator, and causes the attenuation of the transcription. In this way, E. coli will not transcribe the trp operon unless it needs more tryptophan. The ribosome pauses temporarily only when there is a shortage of tryptophan, triggering the eventual synthesis of enzymes that will produce more tryptophan (Landick et al., 1987).

Mode of action of the E. coli trp operon anti-terminator. The position of the ribosome on the mRNA molecule, while both transcription and translation occur in tandem, affects the mRNA tertiary structure and decides between the formation of the anti-terminator or the terminator. A: If the anti-terminator forms, shown by the pairing of regions 2 and 3, then the terminator cannot form, and transcription continues. B: If the anti-terminator does not form, then the terminator will form by pairing regions 3 and 4, and transcription will stop.

Two possible mRNA tertiary conformations, in either the presence (A) or absence (B) of tryptophan. Although transcription of the trp operon has not finished, translation of the nascent mRNA strand begins. Depending on the levels of tryptophan, the elongating mRNA can take on two different conformations. A: The conformation of the trp operon mRNA under normal conditions, when tryptophan is abundant. The transcription-pause loop, shown in yellow, pauses the RNA polymerase and allows the ribosome to catch up, synchronizing transcription and translation. The ribosome does not stall at the tandem tryptophan codons, and the anti-terminator cannot form. The transcriptional terminator does form, and transcription ends. B: Under tryptophan-starved conditions, the conformation of the mRNA is noticeably different. Again, transcription and translation are synchronized due to the presence of the pause stem-loop. However, the ribosome stalls at the tandem tryptophan codons because it is waiting for tRNATrp, which are now rare. Meanwhile, RNA polymerase moves further ahead. The anti-terminator then forms and prevents the downstream terminator from forming. Transcription does not end, and the entire trp operon is transcribed.

Source

It was amplified by PCR using these primers: DNA sequence of forward primer: 5' GCATGAATTCGCGGCCGCTTCTAGACGTAAAAAGGGTATCGACAATGAAA 3'

DNA sequence or reverse primer: 5' GCATCTGCAGCGGCCGCAACTAGTAAAAAAAAGCCCGCTCATTAGG 3'

The primers contain the BioBrick ends, as well as 4 extra bases to facilitate restriction enzyme digestion and subsequent cloning. Template was genomic DNA from JM109.

References

• Landick, Robert, Jannette Carey, and Charles Yanofsky. 1985. “Translation Activates the Paused Transcription Complex and Restores Transcription of the trp Operon Leader Region.” Proceedings of the National Academy of Sciences of the United States of America 82(14), 4663-4667.
• Landick, Robert, Jannette Carey, and Charles Yanofsky. 1987. “Detection of Transcription-Pausing in vivo in the trp Operon Leader Region.” Proceedings of the National Academy of Sciences of the United States of America 84(6), 1507-1511.
• Nudler, E. and M. E. Gottesman. 2002. “Transcription termination and anti-termination in E. coli.” Genes to Cells 7, 755-768.