Difference between revisions of "Part:BBa K2194004:Design"

(References)
(Design Notes)
 
(10 intermediate revisions by the same user not shown)
Line 9: Line 9:
 
The RBS before <i>cysPUWA</i> was designed using the Salis Lab RBS Designer [1]. The pre-sequence used was the <i>PgntK</i> promoter sequence, and the protein-coding sequence used was the <i>cysP</i> sequence. This particular RBS was chosen (see Figure 1 below) because it had the highest translation rate.
 
The RBS before <i>cysPUWA</i> was designed using the Salis Lab RBS Designer [1]. The pre-sequence used was the <i>PgntK</i> promoter sequence, and the protein-coding sequence used was the <i>cysP</i> sequence. This particular RBS was chosen (see Figure 1 below) because it had the highest translation rate.
  
[[File:1/1c/RBS_for_BBa_K2194004.png|600px]]
+
[[File:RBS_for_BBa_K2194004.png|600px]]
 
<p class = "caption"> <b>Figure 1:</b> This image is taken from Salis Lab RBS Designer [1] and highlights the synthetic RBS used in BBa_K2194004.</p>
 
<p class = "caption"> <b>Figure 1:</b> This image is taken from Salis Lab RBS Designer [1] and highlights the synthetic RBS used in BBa_K2194004.</p>
  
Line 21: Line 21:
 
===References===
 
===References===
 
[1] https://salislab.net/software/forward
 
[1] https://salislab.net/software/forward
 +
<br>
 +
 
[2] Chen, Ying-Ja et al. “Characterization of 582 Natural and Synthetic Terminators and Quantification of Their Design Constraints.” Nature Methods 10.7 (2013): 659–664. Web. 1 Nov. 2017.
 
[2] Chen, Ying-Ja et al. “Characterization of 582 Natural and Synthetic Terminators and Quantification of Their Design Constraints.” Nature Methods 10.7 (2013): 659–664. Web. 1 Nov. 2017.

Latest revision as of 00:02, 2 November 2017


Sulfate Transport System w/ Negative Feedback for Membrane Stress


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 1480
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 2296
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

The RBS before cysPUWA was designed using the Salis Lab RBS Designer [1]. The pre-sequence used was the PgntK promoter sequence, and the protein-coding sequence used was the cysP sequence. This particular RBS was chosen (see Figure 1 below) because it had the highest translation rate.

RBS for BBa K2194004.png

Figure 1: This image is taken from Salis Lab RBS Designer [1] and highlights the synthetic RBS used in BBa_K2194004.

Source

See the registry pages for negative feedback membrane stress promoter PgntK (BBa_K2194002), cysPUWA proteins (BBa_K2194003), Elowitz RBS (BBa_B0034), and sulfate binding protein sbp (BBa_K2194001) sources.

The RBS before cysPUWA has the synthetic sequence 5’AAGCGGACGACACACAAGGCTCCACCAAA3’ and was designed with the “Salis Lab RBS Designer” [1].

The terminator “L3S3P21” after sbp has the synthetic sequence 5’CCAATTATTGAAGGCCTCCCTAACGGGGGGCCTTTTTTTGTTTCTGGTCTGCC3’. It is sourced from Chen et al [2] and is notable because it is a strong, recombination-resistant terminator.

References

[1] https://salislab.net/software/forward

[2] Chen, Ying-Ja et al. “Characterization of 582 Natural and Synthetic Terminators and Quantification of Their Design Constraints.” Nature Methods 10.7 (2013): 659–664. Web. 1 Nov. 2017.