Difference between revisions of "Part:BBa K2322006"

Latest revision as of 14:48, 1 November 2017

-AOX1 promoter-S-RBS-gltB-terminater-

The circuit contain AOX1 promoter, the secretion signal, RBS, gltB. This circuit is used to test the expression of gltB. If the circuit works, the gltB will express extracellular in GS115.

AOX1 promoter: Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of gltB, our targeted gene.

Secretion signal: Secretion signal is to prompt a cell to translocate the protein, in this case, the protein that induced by gltB can express extracellular. And in this circuit, after collecting the protein that express outside, we can determine the gltB’s function as a qualitatively way.

RBS: It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA

gltB： Escherichia coli glutamate acid synthase gene (gltB) is found in the Escherichia coli. Saccharomyces cerevisiae glutamate acid-6-phosphate synthase (GltB ) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.

Figure1: The image of Escherichia coli glutamate acid.

It is assumed that gltB can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the glutamate acid. The changing in the expression of gltB can positively affect the amount of glutamate acid in the cell. Glutamate is a key compound in cellular metabolism. It is a metabolic fuel. A key process in amino acid degradation is transamination, in which the amino group of an amino acid is transferred to an α-ketoacid, typically catalyzed. R1-amino acid + R2-α-ketoacid ⇌ R1-α-ketoacid + R2-amino acid Alanine + α-ketoglutarate ⇌ pyruvate + glutamate Aspartate + α-ketoglutarate ⇌ oxaloacetate + glutamate So during a osmotic high environment, with the induced in the certain condition, it will increase the rate of the metabolism.

Figure 2:The simplified molecular diagram of Glutamate acid

Figure 3:The actual diagram of Glutamate acid

With more gltB expressed, there will be more glutamate acid in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether gltB will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.

Primer of this part AOX-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT Glt-B-RP: TGACACCTTGCCCTTTTTTGCCGGACTGCAGTTAAACAAATGGTGCAGCATCATGC

Sequence and Features