Difference between revisions of "Part:BBa K2322004"

Latest revision as of 12:30, 1 November 2017

--gltB--

Escherichia coli glutamate acid synthase gene (gltB) is found in the Escherichia coli. Saccharomyces cerevisiae glutamate acid-6-phosphate synthase (GltB ) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.

Figure1: The image of Escherichia coli glutamate acid.

It is assumed that gltB can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the glutamate acid. The changing in the expression of gltB can positively affect the amount of glutamate acid in the cell. Glutamate is a key compound in cellular metabolism. It is a metabolic fuel. A key process in amino acid degradation is transamination, in which the amino group of an amino acid is transferred to an α-ketoacid, typically catalyzed. R1-amino acid + R2-α-ketoacid ⇌ R1-α-ketoacid + R2-amino acid Alanine + α-ketoglutarate ⇌ pyruvate + glutamate Aspartate + α-ketoglutarate ⇌ oxaloacetate + glutamate So during a osmotic high environment, with the induced in the certain condition, it will increase the rate of the metabolism.

Figure 2:The simplified molecular diagram of Glutamate acid

Figure 3:The actual diagram of Glutamate acid

With more gltB expressed, there will be more glutamate acid in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether gltB will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.

Primer of this part: Glt-B-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAATGACTAGAAAACCAAGAAGACATG Glt-B-RP: TGACACCTTGCCCTTTTTTGCCGGACTGCAGTTAAACAAATGGTGCAGCATCATGC

Sequence and Features