Difference between revisions of "Part:BBa K2281004"

Latest revision as of 00:36, 2 November 2017

-T7 promoter-lacI operator-RBS-HbOYE-

Introduction

T7-promoter-F primer: TTTCGCTAAGGATGATTTCTGGTAATACGACTCACTATAGGG

R-primer,NEB-HbOYE1-R-PstI,ACCTTGCCCTTTTTTGCCGGACTCAAAGGCGTGATCGTGGC

Description: When ligated with T7 promoter, lacI operator, RBS, HbOYE can express properly in E. Coli. The part includes a strong ribosomal binding site. Its strength was determined by cloning it in front of mRFP1 reporter and measuring fluorescence of BL21 cells containing a low copy number plasmid containing the report.

T7 Promoter primer: a strong primer that can express at any time, any cell under any circumstance, so it motivates the expression of HbOYE.

lacI operator: a lactose opteron consisting promoter and other cis-acting elements. In this part, lacI operator is regulated by T7 promoter. To make lacI operator function, inductor IPTG is added.

HbOYE:

LOCUS DQ004685

SIZE 1455 bp

DEFINITION Hevea brasiliensis 12-oxophytodienoate reductase (opr).

HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.

(More information about HbOYE is on the page of part BBa_K2281006)

Experiments

HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which functions as a reductase. In our experiment, HbOYE bolsters the production of cireonellol from geraniol. Our goal is to combine OYE gene with GES to create an integrated pathway. The pathway will make glucose experience MVA and DXP pathway to be Geranyl diphosphate and then transform into citronellol directly. Therefore, the synthesis of citronellol can be more efficient than ever. In the experiment, we utilize electrophoresis to check whether the properties of real material is the same as the theoretical one. Only if they are perfectly match, we can perform the latter experiments successfully.

As the picture shown above, the part is successfully ligated into pSB1C3.The left column is the marker, and the two strips on the right are PCR products of the T7 promoter+lacI operator+RBS+HbOYE.

From Zeng’s research showed that different OYE gene in E.coli and yeast can induce different production of citronellol. Thus, in this part, we choose HbOYE to perform the experiment.

In the later step, we are going to construct two plasmids，one contain GES gene, and the other one contain OYE genes, the two plasmids can be transform to one cell. Finally, we will obtain our target product---citronellol. The part is successfully ligated into pSB1C3.The left column is the marker, and the two strips on the right are PCR products of the HbOYE+P2A+PcGES.

Fig 2 Th e SDS-PAGE electrophoresis of recombinant protein Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. Black arrow shows the targeted recombinant proteins. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours.

Fig 3 Western blot result using HIS antibody. Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours; The first antibody used in Western blotting is Kangwei biocompany-CW0304S and the second antibody is Kangwei biocompany-CW0102S.

References

Ying ZENG et al. ‘Identification of enzymes responsible for the reduction of geraniol to Citronellol’. DOI 10.1007/s13659-011-0032-6

Gareth Norton et al.. ‘Characterisation of recombinant Hevea brasiliensis allene oxide synthase: Effects of cycloxygenase inhibitors, lipoxygenase inhibitors and salicylates on enzyme activity’. Plant Physiology and Biochemistry 45 (2007) 129-138.

Zeng Ying et al. ‘Identification of Enzymes Responsible for the Reduction of Geraniol to Citronellol’. Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, 650201

Sequence and Features