Difference between revisions of "Part:BBa K2281001"

(Experiments)
 
(14 intermediate revisions by 2 users not shown)
Line 54: Line 54:
 
In our experiments, due to the position of domain, we have to ligate F2A to the downstream of HbOYE by using bridge PCR. Then this integration is ligated to PcOYE to form a whole. The product is our part. The diagram below shows the original pathway of citronellol production. However, by using our part, the last two steps will be combined together and the efficiency will be improved.
 
In our experiments, due to the position of domain, we have to ligate F2A to the downstream of HbOYE by using bridge PCR. Then this integration is ligated to PcOYE to form a whole. The product is our part. The diagram below shows the original pathway of citronellol production. However, by using our part, the last two steps will be combined together and the efficiency will be improved.
  
[[File:T--CIEI-BJ--Background--parts_fig1.jpg|900px]]
+
[[File:Mosquito_parts-figure1.png|center|940px|img]]
 +
 
 +
Information about bridge PCR: In MAST (mRNA accessible site tagging), the DNA tags from synthesized library were employed for identifying mRNA accessible sites. A large number of tags were amplified and subcloned for sequencing to verify mRNA binding profiles. A PCR was designed by using one primer which bridges over the tag terminal sequences. In PCR reaction DNA tag fragments were concatemerized by a bridge primer in reaction cycles.
 +
 
 +
[[File:Mosquito-bj-jiao4.png|center|380px|img]]
 +
The part is successfully ligated into pSB1C3.The left column is the marker, and lane 1and lane2 on the right are PCR products of the HbOYE+P2A+PcGES.
 +
 
 +
Primer sequence-
 +
 
 +
NEB-HbOYE-F-EcoRI:TTTCGCTAAGGATGATTTCTGGATGGCTGAAACTGGAAC
 +
 
 +
NEB-HbOYE+2A+PcGES-R-PstI:ACCTTGCCCTTTTTTGCCGGACTCAAATAGAAGATGGCAA
 +
 
 +
 
 +
[[File:Mosquito-bj-jiao2.png|center|940px|img]]
 +
Fig 2 Th e SDS-PAGE electrophoresis of recombinant protein Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. Black arrow shows the targeted recombinant proteins. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours.
 +
 
 +
 
 +
[[File:Mosquito-bj-jiao1.png|center|940px|img]]
 +
Fig 3 Western blot result using HIS antibody. Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours; The first antibody used in Western blotting is Kangwei biocompany-CW0304S and the second antibody is Kangwei biocompany-CW0102S
  
Information about bridge PCR: In MAST (mRNA accessible site tagging), the DNA tags from synthesized library were employed for identifying mRNA accessible sites. A large number of tags were amplified and subcloned for sequencing to verify mRNA binding profiles. A PCR was designed by using one primer which bridges over the tag terminal sequences. In PCR reaction DNA tag fragments were concatemerized by a bridge primer in reaction cycles.
 
  
 
===Purpose for designing this part===
 
===Purpose for designing this part===

Latest revision as of 00:32, 2 November 2017


-HbOYE-F2A-PcGES-

T--CIEI-BJ--part--001.jpg

HbOYE

LOCUS DQ004685

SIZE 1455 bp

DEFINITION Hevea brasiliensis 12-oxophytodienoate reductase (opr).

HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.

(More information about HbOYE is on the page of part BBa_K2281006)

F2A

F2A sequence: CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGGGCCC

2A, known as CHYSEL polypeptides, contains the peptide bond to grow the peptide chain which helps to link two genes. The presence of the conserved CHYSEL residues in the peptides (Donnelly et al., 1997; Ryan et al., 2002) contributes to form a torsion which causes the peptide chain to be released later (Ryan et al., 2002), and then the two genes can express in a cell separately.

SOURCE

 The foot-and-mouth disease virus (FMDV) is the pathogen that causes foot-and-mouth disease.
 It is a picornavirus, the prototypical member of the Aphthovirus genus. 
 The disease, which causes vesicles (blisters) in the mouth and feet of bovids, suids, ovids, 
 caprids and other cloven-hoofed animals is highly infectious and a major plague of animal farming.

PcGES

LOCUS KF926075

SIZE 1734 bp

DEFINITION Pogostemon cablin geraniol synthase (GS1)

PcGES stands for Pogostemon cablin geraniol synthase (GS1) mRNA which is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate (GPP) can be produced. Then PcGES helps convert GPP to geraniol.

SOURCE Pogostemon cablin (patchouli)

 ORGANISM  Pogostemon cablin
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
           Pentapetalae; asterids; lamiids; Lamiales; Lamiaceae; Lamioideae;
           Pogostemoneae; Pogostemon.
                                 T--CIEI-BJ--part002--source.jpg

Patchouli (Pogostemon cablin) is a species of plant from the genus Pogostemon. It is a bushy herb of the mint family, with erect stems, reaching around 75 centimetres (2.5 ft) in height and bearing small, pale pink-white flowers. The plant is native to tropical regions of Asia, and is now extensively cultivated in China, Indonesia, Cambodia, Myanmar, India, Maldives, Malaysia, Mauritius, Seychelles, Madagascar, Taiwan, Philippines, Thailand, Vietnam, South America and the Caribbean.

Experiments

In our experiments, due to the position of domain, we have to ligate F2A to the downstream of HbOYE by using bridge PCR. Then this integration is ligated to PcOYE to form a whole. The product is our part. The diagram below shows the original pathway of citronellol production. However, by using our part, the last two steps will be combined together and the efficiency will be improved.

img

Information about bridge PCR: In MAST (mRNA accessible site tagging), the DNA tags from synthesized library were employed for identifying mRNA accessible sites. A large number of tags were amplified and subcloned for sequencing to verify mRNA binding profiles. A PCR was designed by using one primer which bridges over the tag terminal sequences. In PCR reaction DNA tag fragments were concatemerized by a bridge primer in reaction cycles.

img

The part is successfully ligated into pSB1C3.The left column is the marker, and lane 1and lane2 on the right are PCR products of the HbOYE+P2A+PcGES.

Primer sequence-

NEB-HbOYE-F-EcoRI:TTTCGCTAAGGATGATTTCTGGATGGCTGAAACTGGAAC

NEB-HbOYE+2A+PcGES-R-PstI:ACCTTGCCCTTTTTTGCCGGACTCAAATAGAAGATGGCAA


img

Fig 2 Th e SDS-PAGE electrophoresis of recombinant protein Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. Black arrow shows the targeted recombinant proteins. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours.


img

Fig 3 Western blot result using HIS antibody. Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours; The first antibody used in Western blotting is Kangwei biocompany-CW0304S and the second antibody is Kangwei biocompany-CW0102S


Purpose for designing this part

The whole purpose of our project is to optimize the efficiency of producing citronellol, so as we combine GES and OYE with 2A, the productive efficiency will be achieved. As for this goal, this part is essential for our project. When functioning, since 2A functions as separating GES gene and OYE gene, which can be automatic removed by cell itself, two independent proteins can be synthesized properly throughout the process. Therefore, but only the final product will be same as before, but also the efficiency is improved.

References

REFERENCE 1 (bases 1 to 1734)

 AUTHORS   Ouyang,P., Zeng,S. and Mo,X.
 TITLE     Cloning and Expression Analysis patchouli geraniol synthase Clone
           and Expression Analysis of Geraniol Synthase Gene in Pogostemon
           cablin
 JOURNAL   Xibei Zhiwu Xuebao 36, 5 (2016)

REFERENCE 2 (bases 1 to 1734)

 AUTHORS   Ouyang,P. and Mo,X.
 TITLE     Direct Submission
 JOURNAL   Submitted (26-NOV-2013) Traditional Chinese Medicine, Guangdong
           Food and Grug Vocational College, Longdong North Road No. 321,
           Tianhe District, Guangzhou, Guangdong 510520, China


REFERENCE 3

 AUTHORS   Mao, Jian Ping
 TITLE   Bridge PCR,An Easy Way for Concatemerizing DNA Tags
 JOURNAL   China Biotechnology (2009).

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]