Difference between revisions of "Collections/Cell-Free TX-TL"

m
 
(One intermediate revision by the same user not shown)
Line 3: Line 3:
 
{{Catalog/Curation/User_Collection}}
 
{{Catalog/Curation/User_Collection}}
  
−
This year our team (Lethbridge Collegiate) has put all the protein components of a cell-free transcription-translation (TX-TL) system in BioBrick standard with affinity purification tags. The idea is to provide an easy to express and purify TX-TL system that anyone can perform and use for protein synthesis testing or teaching.
+
N<i>ex</i>t <i>vivo</i>
  
−
We sought to make all the TX-TL components available to all iGEM teams so anyone could easily produce this system for cell-free protein expression. In total there are 38 TX-TL proteins that we would like to register as a parts collection.  
+
Our part collection will contain all the major biomolecules required for a cell-free transcription-translation system providing them in an easy to express and purify way that anyone can easily produce for their experimental purposes. These biomolecules include:
  
−
This collection will grow as we continue to develop a tRNA and ribosome purification strategy in BioBrick standard as well.  
+
    <ul class="text12" style="list-style: disc">
 +
        <li class="text12"><b>38</b>  Transcription and Translation (TX-TL) protein genes codon optimized for <i>E. coli</i> expression</li>
 +
        <li class="text12"><b>20</b>  N<i>ex</i>t <i>vivo</i> MS2-tagged tRNA isolation genes</li>
 +
        <li class="text12"><b>2</b>    MS2-tagged ribosomal rRNA genes for isolation of functional ribosomes from the cell lysate</li>
 +
    </ul>
 +
 
 +
<br>
 +
<b>TX-TL Proteins:</b> The initial focus for this collection was submitting all 38 TX-TL protein genes, codon optimized, hexahistidine tagged, and under the control of a T7 promoter system for controlled expression. We have submitted and characterized 9 of these parts to the registry in pSB1C3, characterized expression of 17 parts, and are working toward completing the remaining parts following the competition.
 +
 
 +
<b>tRNA:</b> The tRNA component of the N<i>ex</i>t <i>vivo</i> system was another of our focuses for this years project. Currently, no simple protocol exists for efficient and specific isolation of tRNA from the cell. We are happy to announce that we were able to develop a system that allows for the purification of specific, fully modified tRNA from cell lysate. The first tRNA in our part collection is that of tRNA<sup>Phe</sup>. With the success of our purification strategy, we plan to synthesize the remaining tRNA in our expression construct for submission into this collection.
 +
 
 +
<b>Ribosomes:</b> Currently we plan to BioBrick both the 23S and 16S <i>E. coli</i> ribosomal rRNA genes with the MS2 hairpin added into either sequence at a region that places it externally on the 3D ribosome structure. This design has previously been used before by another research lab to purify whole ribosomes using the MS2 binding protein tagged with a hexahistidine tag.
 +
 
 +
<b>MS2BP:</b> The MS2 binding protein is a central component to our tRNA and ribosome purification strategies. It was previously submitted by the 2016 Lethbridge iGEM team and we feel it would be a great addition to our N<i>ex</i>t <i>vivo</i> Part Collection.
 +
 
 +
<b>Validation:</b> Finally, we have also included our measurement control construct for the complete TX-TL system. This part expresses a RNA Spinach tagged EYFP mRNA and EYFP protein, that in the addition of DFHBI produces both green and yellow fluorescence indicating transcription and translation respectively.  
  
 
<parttable>collection_cell_free_tx_tl</parttable>
 
<parttable>collection_cell_free_tx_tl</parttable>
 
*To add to this list, please use the category '''//collections/cell-free_tx-tl'''
 
*To add to this list, please use the category '''//collections/cell-free_tx-tl'''

Latest revision as of 22:57, 1 November 2017

This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.

Next vivo

Our part collection will contain all the major biomolecules required for a cell-free transcription-translation system providing them in an easy to express and purify way that anyone can easily produce for their experimental purposes. These biomolecules include:

  • 38 Transcription and Translation (TX-TL) protein genes codon optimized for E. coli expression
  • 20 Next vivo MS2-tagged tRNA isolation genes
  • 2 MS2-tagged ribosomal rRNA genes for isolation of functional ribosomes from the cell lysate


TX-TL Proteins: The initial focus for this collection was submitting all 38 TX-TL protein genes, codon optimized, hexahistidine tagged, and under the control of a T7 promoter system for controlled expression. We have submitted and characterized 9 of these parts to the registry in pSB1C3, characterized expression of 17 parts, and are working toward completing the remaining parts following the competition.

tRNA: The tRNA component of the Next vivo system was another of our focuses for this years project. Currently, no simple protocol exists for efficient and specific isolation of tRNA from the cell. We are happy to announce that we were able to develop a system that allows for the purification of specific, fully modified tRNA from cell lysate. The first tRNA in our part collection is that of tRNAPhe. With the success of our purification strategy, we plan to synthesize the remaining tRNA in our expression construct for submission into this collection.

Ribosomes: Currently we plan to BioBrick both the 23S and 16S E. coli ribosomal rRNA genes with the MS2 hairpin added into either sequence at a region that places it externally on the 3D ribosome structure. This design has previously been used before by another research lab to purify whole ribosomes using the MS2 binding protein tagged with a hexahistidine tag.

MS2BP: The MS2 binding protein is a central component to our tRNA and ribosome purification strategies. It was previously submitted by the 2016 Lethbridge iGEM team and we feel it would be a great addition to our Next vivo Part Collection.

Validation: Finally, we have also included our measurement control construct for the complete TX-TL system. This part expresses a RNA Spinach tagged EYFP mRNA and EYFP protein, that in the addition of DFHBI produces both green and yellow fluorescence indicating transcription and translation respectively.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K2109108MS2 6XHis (V29I/d1FG)CompositeAndy Hudson640  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443000AlaRS optimized for expression in E. coli CompositeLethbridge iGEM 20172862  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443001ArgRS optimized for expression in E. coli CompositeLethbridge iGEM 20171965  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443002AsnRS optimized for expression in E. coli CompositeLethbridge iGEM 20171632  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443003AspRS optimized for expression in E. coli CompositeLethbridge iGEM 20172004  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443004CysRS optimized for expression in E. coli CompositeLethbridge iGEM 20171617  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443005GlnRS optimized for expression in E. coli CompositeLethbridge iGEM 20171899  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443006GluRS optimized for expression in E. coli CompositeLethbridge iGEM 20171650  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443007GlyRS Alpha subunit optimized for expression in E. coli CompositeLethbridge iGEM 20171143  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443008GlyRS Beta subunit optimized for expression in E. coli CompositeLethbridge iGEM 20172301  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443009HisRS optimized for expression in E. coli CompositeLethbridge iGEM 20171506  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443010IleRS optimized for expression in E. coli CompositeLethbridge iGEM 20173048  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443011LeuRS optimized for expression in E. coli CompositeLethbridge iGEM 20172814  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443012LysRS optimized for expression in E. coli CompositeLethbridge iGEM 20171750  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443013MetRS optimized for expression in E. coli CompositeLethbridge iGEM 20172265  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443014PheRS Alpha subunit optimized for expression in E. coli CompositeLethbridge iGEM 20171215  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443015PheRS Beta subunit optimized for expression in E. coli CompositeLethbridge iGEM 20172619  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443016ProRS optimized for expression in E. coli CompositeLethbridge iGEM 20171950  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443017SerRS optimized for expression in E. coli CompositeLethbridge iGEM 20171524  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443018ThrRS optimized for expression in E. coli CompositeLethbridge iGEM 20172160  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443019TrpRS optimized for expression in E. coli CompositeLethbridge iGEM 20171236  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443020TyrRS optimized for expression in E. coli CompositeLethbridge iGEM 20171506  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443021ValRS optimized for expression in E. coli CompositeLethbridge iGEM 20173087  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443022MTF optimized for expression in E. coli CompositeLethbridge iGEM 20171179  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443023IF1 optimized for expression in E. coli CompositeLethbridge iGEM 2017456  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443024IF2 optimized for expression in E. coli CompositeLethbridge iGEM 20172904  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443025IF3 optimized for expression in E. coli CompositeLethbridge iGEM 2017774  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443026EF-G optimized for expression in E. coli CompositeLethbridge iGEM 20172346  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443027EF-Tu optimized for expression in E. coli CompositeLethbridge iGEM 20171419  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443028EF-Ts optimized for expression in E. coli CompositeLethbridge iGEM 20171083  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443029RF1 optimized for expression in E. coli CompositeLethbridge iGEM 20171314  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443030RF2 optimized for expression in E. coli CompositeLethbridge iGEM 20171329  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443031RF3 optimized for expression in E. coli CompositeLethbridge iGEM 20171821  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443032RRF optimized for expression in E. coli CompositeLethbridge iGEM 2017789  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443033MK optimized for expression in E. coli CompositeLethbridge iGEM 2017879  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443034CK optimized for expression in E. coli CompositeLethbridge iGEM 20171377  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443035NDK optimized for expression in E. coli CompositeLethbridge iGEM 2017717  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443036PPiase optimized for expression in E. coli CompositeLethbridge iGEM 2017822  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443037T7 RNA Polymerase optimized for expression in E. coli CompositeLethbridge iGEM 20172886  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443038tRNAPhe-MS2CompositeLethbridge iGEM 2017300  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2443039EYFP-Spinach transcription and translation (TX-TL) measurement deviceMeasurementLethbridge iGEM 20171063  . . . caccttcgggtgggcctttctgcgtttata
BBa_K2722000Exonuclease V, Subunit RecCCodingEnik Baligcs3369  . . . ttaccgctgtttcgctttaatcagtcatga
BBa_K2722001Exonuclease V, Subunit RecDCodingEnik Baligcs1827  . . . ctggcggcgttgtttagttcgcgggaataa
BBa_K27220026 times Chi recombination hotspot to inhibit Exonuclease V (RecBCD) activityDNAEnik Baligcs92  . . . gccactgctggtggccactgctggtggcca
  • To add to this list, please use the category //collections/cell-free_tx-tl