Difference between revisions of "Part:BBa K2273114"
| (9 intermediate revisions by the same user not shown) | |||
| Line 33: | Line 33: | ||
<html> | <html> | ||
| − | <figure style="width: | + | <figure style="width:95%;float:left;"> |
<figcaption><b>Table 1: Antibiotic concentrations in [µg µl<sup>-1</sup>] (final concentration in the well) used in the plate reader assay. | <figcaption><b>Table 1: Antibiotic concentrations in [µg µl<sup>-1</sup>] (final concentration in the well) used in the plate reader assay. | ||
</b></figcaption> | </b></figcaption> | ||
| − | <img src="https://static.igem.org/mediawiki/2017/8/86/T--TU_Dresden--P_Biosensor_Table2_betalactamconcentrations.png"width=" | + | <img src="https://static.igem.org/mediawiki/2017/8/86/T--TU_Dresden--P_Biosensor_Table2_betalactamconcentrations.png"width="95%"> |
</figure> | </figure> | ||
</html> | </html> | ||
<br> | <br> | ||
| − | In pre-tests, we investigated the growth of <i>B. subtilis</i> wild type and the PenP mutant, upon exposure to different concentrations of each tested β-lactam (data not shown). After that, we narrowed these down to two concentrations per antibiotic (see Table 1). Since we did not want to kill our biosensors, we focused on β-lactam concentrations which result in a slight inhibition of growth. These concentrations were used for all following experiments to further characterise our biosensors and the effect of the <i>B. subtilis</i> native β-lactamase (PenP) (see Figure 1). [http://2017.igem.org/Team:TU_Dresden/Experiments Plate reader] experiments were performed in [http://2017.igem.org/Team:TU_Dresden/Experiments Mueller Hinton] (MH) media, induction with the antibiotics was carried out after one hour of incubation at 37˚C in the plate reader. Growth was monitored every five minutes for at least 18h.<br> | + | <br>In pre-tests, we investigated the growth of <i>B. subtilis</i> wild type and the PenP mutant, upon exposure to different concentrations of each tested β-lactam (data not shown). After that, we narrowed these down to two concentrations per antibiotic (see Table 1). Since we did not want to kill our biosensors, we focused on β-lactam concentrations which result in a slight inhibition of growth. These concentrations were used for all following experiments to further characterise our biosensors and the effect of the <i>B. subtilis</i> native β-lactamase (PenP) (see Figure 1). [http://2017.igem.org/Team:TU_Dresden/Experiments Plate reader] experiments were performed in [http://2017.igem.org/Team:TU_Dresden/Experiments Mueller Hinton] (MH) media, induction with the antibiotics was carried out after one hour of incubation at 37˚C in the plate reader. Growth was monitored every five minutes for at least 18h.<br> |
| Line 71: | Line 71: | ||
</html> | </html> | ||
<br> | <br> | ||
| − | The analysis of the induction of P<i><sub>penP</sub></i> by different β-lactam antibiotics unfolded that this promoter seems to be constitutively active during exponential phase (see Figure 1). As the exact promoter length and potential regulatory regions upstream are still unidentified, two versions (short and long) of the promoter have been examined.< | + | <br> |
| − | + | The analysis of the induction of P<i><sub>penP</sub></i> by different β-lactam antibiotics unfolded that this promoter seems to be constitutively active during exponential phase (see Figure 1). As the exact promoter length and potential regulatory regions upstream are still unidentified, two versions (short and long) of the promoter have been examined.<br> | |
| + | The RLU/OD<sub>600</sub> values shown in Figure 6 indicate a moderate promoter activity during exponential growth. There is no noticeable difference between the strains with a functional PenP enzyme <b>(a)</b> and the <i>penP</i> mutant <b>(b)</b> (see Figure 1). We could not observe a particular activation by β-lactam antibiotics, which suggests that this enzyme is produced might have other functionalities, too.<br> | ||
| + | |||
| + | <html> | ||
| + | <img src="https://static.igem.org/mediawiki/2017/2/2d/T--TU_Dresden--P_Biosensor_Figure8.png"width="90%"> | ||
| + | <figcaption><b>Figure 8: Results from the Disk Diffusion Assay with the P<sub><i><b>penP(long)</b></i></sub> reporter strains.</b> Daylight pictures (top row) and luminescence detection using a chemiluminescence dock (with two minutes exposure time). Top right scheme shows the disk layout together with the antibiotics applied in the assay. Please note: only results for the long version of the promoter are shown, as the short version behaves accordingly. | ||
| + | </figcaption></figure> | ||
| + | </html> | ||
| + | <br> | ||
| + | We performed disk diffusion assays with the P<sub><i>PenP</i></sub>(short and long version) reporter strains and checked if any of the β-lactams would lead to a luminescence signal (Figure 2). Unfortunately, none of the tested substance lead to a notable luminescence. We again could only observe a weak basal promoter activity (as in liquid) with both reporter strains. The measured diameters of the inhibition zones are summarised in Table 2. Taking these results together with the observations in liquid (Figure 6), we can state that the native β-lactamase in <i>B. subtilis</i> dose not respond to any of our tested β-lactams. <br> | ||
<html> | <html> | ||
| Line 81: | Line 90: | ||
<img src="https://static.igem.org/mediawiki/2017/4/44/T--TU_Dresden--P_Biosensor_Table8.png"width="90%"> | <img src="https://static.igem.org/mediawiki/2017/4/44/T--TU_Dresden--P_Biosensor_Table8.png"width="90%"> | ||
</figure> | </figure> | ||
| − | |||
| − | + | References: | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4422635/ 1] C. Lee Ventola, MS (2015) The antibiotic resistance crisis: part 2: management strategies and new agents. Pharmacy and Therapeutics 40(5), 344–352 | |
| − | + | [https://www.aerzteblatt.de/archiv/52563 2] www.aerzteblatt.de, visited 08/23/17 (5:34pm) | |
| − | + | [http://www.who.int/mediacentre/factsheets/fs194/en/ 3] www.who.int, visited 09/04/17 (3:21pm) | |
| − | + | [https://en.wikipedia.org/wiki/Β-lactam_antibiotic 4] https://en.wikipedia.org/wiki/Β-lactam_antibiotic, visited 10/27/17 (4:42pm) | |
| + | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778/ 5] Leticia I. Llarrull, Mary Prorok, and Shahriar Mobashery (2010) Binding of the Gene Repressor BlaI to the bla Operon in Methicillin-Resistant Staphylococcus aureus. Biochemistry 49(37), 7975–7977 Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013) | ||
| + | [https://jbioleng.biomedcentral.com/articles/10.1186/1754-1611-7-29 6] The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7(29),[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684797/ 7] Toth, M., Antunes, N.T., Stewart, N.K., Frase, H., Bhattacharya, M., Smith, C. and Vakulenko, S. (2016) Class D β-lactamases do exist in Gram-positive bacteria. Nature Chemical Biology 12(1),9-14 | ||
Latest revision as of 03:52, 2 November 2017
Beta-lactamase encoding gene penP found in B. subtilis
This gene is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. It codes for a beta-lactamase found in Bacillus subtilis. Yet there is not much known about the activity and activation of the beta-lactamase PenP in B. subtilis. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3] PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. This enzyme also harbours a n-terminal signal peptide sequence and is most likely secreted and therefore localized outside of the cell. [http://www.uniprot.org/uniprot/P39824] To investigate the influence that the presence of the beta-lactamase PenP in B.subtilis has on the sensitivity our biosensor, we analyzed the promoter activity of PpenP under antibiotic stress conditions. We amplified a short and a longer version of this promoter to potentially take into account all regulatory regions upstream of the penP gene.
This part features the RFC25 prefix and suffix to enable translational fusions:
| Prefix with | EcoRI, NotI, XbaI, RBS, spacer sequence, Start Codon and NgoMIV | GAATTCGCGGCCGCTTCTAGAAGGAGGTGTCAAAATGGCCGGC |
| Suffix with | AgeI, Stop Codon, SpeI, NotI and PstI | ACCGGTTAAACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red, AgeI and NgoMIV in orange)
Beta-Lactam Biosensor
Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.
The role of the beta-lactamase PenP in resistance against beta-lactam antibiotics
In this project we examined the influence of the presence of PenP on our biosensor`s performance. Therefore we investigated the activity of the PpenP promoter in the presence of different beta-lactam antibiotics and two controls (bacitracin and water) in a plate reader assay. The six beta-lactam antibiotics were: ampicillin, carbenicillin, cefoperazone, cefalexin, cefoxitin and penicillin G.
In pre-tests, we investigated the growth of B. subtilis wild type and the PenP mutant, upon exposure to different concentrations of each tested β-lactam (data not shown). After that, we narrowed these down to two concentrations per antibiotic (see Table 1). Since we did not want to kill our biosensors, we focused on β-lactam concentrations which result in a slight inhibition of growth. These concentrations were used for all following experiments to further characterise our biosensors and the effect of the B. subtilis native β-lactamase (PenP) (see Figure 1). [http://2017.igem.org/Team:TU_Dresden/Experiments Plate reader] experiments were performed in [http://2017.igem.org/Team:TU_Dresden/Experiments Mueller Hinton] (MH) media, induction with the antibiotics was carried out after one hour of incubation at 37˚C in the plate reader. Growth was monitored every five minutes for at least 18h.
We expected a higher growth inhibition with rising antibiotic concentrations. In the penP mutant we expected an increased sensitivity towards the β-lactam antibiotics. Addition of water to the culture should not show any effect on the growth and serves as a control. We included a non beta-lactam (the peptide antibiotic bacitracin) in all our assays to demonstrate the specificity of the biosensor.
The analysis of the induction of PpenP by different β-lactam antibiotics unfolded that this promoter seems to be constitutively active during exponential phase (see Figure 1). As the exact promoter length and potential regulatory regions upstream are still unidentified, two versions (short and long) of the promoter have been examined.
The RLU/OD600 values shown in Figure 6 indicate a moderate promoter activity during exponential growth. There is no noticeable difference between the strains with a functional PenP enzyme (a) and the penP mutant (b) (see Figure 1). We could not observe a particular activation by β-lactam antibiotics, which suggests that this enzyme is produced might have other functionalities, too.
We performed disk diffusion assays with the PPenP(short and long version) reporter strains and checked if any of the β-lactams would lead to a luminescence signal (Figure 2). Unfortunately, none of the tested substance lead to a notable luminescence. We again could only observe a weak basal promoter activity (as in liquid) with both reporter strains. The measured diameters of the inhibition zones are summarised in Table 2. Taking these results together with the observations in liquid (Figure 6), we can state that the native β-lactamase in B. subtilis dose not respond to any of our tested β-lactams.
