Difference between revisions of "Part:BBa K2322007"

 
(4 intermediate revisions by one other user not shown)
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K2322007 short</partinfo>
 
<partinfo>BBa_K2322007 short</partinfo>
 +
 +
https://static.igem.org/mediawiki/parts/9/90/Flora.png
  
 
The Schizosaccharomyces pombe 972h- chromosome I (SpTPS1) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.
 
The Schizosaccharomyces pombe 972h- chromosome I (SpTPS1) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.
  
 
+
https://static.igem.org/mediawiki/parts/d/d5/Part%E7%94%A8No.2.png
 
Figure1: The image of Schizosaccharomyces pombe.
 
Figure1: The image of Schizosaccharomyces pombe.
  
Line 12: Line 14:
 
Trehalose, as a small molecules substance, can increase the cell’s ability of regulating the osmotic pressure. When the osmotic pressure from the environment is too high, the cell will face the dangerous of dehydration or plasmolysis. Trehalose can turn into a gel phase when the cells are dehydrated. The gel phase sugar can prevents the further disruption of internal cell organelles, because the gel can splinting the cell organelles in position.
 
Trehalose, as a small molecules substance, can increase the cell’s ability of regulating the osmotic pressure. When the osmotic pressure from the environment is too high, the cell will face the dangerous of dehydration or plasmolysis. Trehalose can turn into a gel phase when the cells are dehydrated. The gel phase sugar can prevents the further disruption of internal cell organelles, because the gel can splinting the cell organelles in position.
 
                                  
 
                                  
Figure 2:
+
https://static.igem.org/mediawiki/parts/2/23/Part%E7%94%A8No.3.png
The simplified molecular diagram of trehalose (C12H22O11).  
+
  
With more SpTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether SpTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.
 
  
 +
With more SpTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether SpTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.
  
 +
Primer of this part
 +
SP-B-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAATGTCAGATGCACATGATACTATTA
 +
SP-B-RP: TGACACCTTGCCCTTTTTTGCCCGGACTGCAGTTAAGAAGAAGAGTTCATAGACAAAAC
  
  

Latest revision as of 12:41, 1 November 2017


--SpTPS1--

Flora.png

The Schizosaccharomyces pombe 972h- chromosome I (SpTPS1) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.

Part%E7%94%A8No.2.png Figure1: The image of Schizosaccharomyces pombe.


It is assumed that SpTPS1 can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the trehalose. The changing in the expression of SpTPS1 can positively affect the amount of trehalose in the cell. Trehalose, as a small molecules substance, can increase the cell’s ability of regulating the osmotic pressure. When the osmotic pressure from the environment is too high, the cell will face the dangerous of dehydration or plasmolysis. Trehalose can turn into a gel phase when the cells are dehydrated. The gel phase sugar can prevents the further disruption of internal cell organelles, because the gel can splinting the cell organelles in position.

Part%E7%94%A8No.3.png


With more SpTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether SpTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.

Primer of this part SP-B-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAATGTCAGATGCACATGATACTATTA SP-B-RP: TGACACCTTGCCCTTTTTTGCCCGGACTGCAGTTAAGAAGAAGAGTTCATAGACAAAAC


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]