Difference between revisions of "Part:BBa K2281001"
JerryZhang (Talk | contribs) |
JerryZhang (Talk | contribs) |
||
(22 intermediate revisions by 3 users not shown) | |||
Line 15: | Line 15: | ||
HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol. | HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol. | ||
− | (More information about HbOYE is on the page of part BBa_K2281006) | + | (More information about HbOYE is on the page of part [https://parts.igem.org/Part:BBa_K2281006#Introduction BBa_K2281006]) |
===F2A=== | ===F2A=== | ||
Line 25: | Line 25: | ||
SOURCE | SOURCE | ||
− | The foot-and-mouth disease virus (FMDV) is the pathogen that causes foot-and-mouth disease. | + | The foot-and-mouth disease virus (FMDV) is the pathogen that causes foot-and-mouth disease. |
+ | It is a picornavirus, the prototypical member of the Aphthovirus genus. | ||
+ | The disease, which causes vesicles (blisters) in the mouth and feet of bovids, suids, ovids, | ||
+ | caprids and other cloven-hoofed animals is highly infectious and a major plague of animal farming. | ||
===PcGES=== | ===PcGES=== | ||
Line 33: | Line 36: | ||
SIZE 1734 bp | SIZE 1734 bp | ||
− | DEFINITION Pogostemon cablin geraniol synthase (GS1) | + | DEFINITION Pogostemon cablin geraniol synthase (GS1) |
PcGES stands for Pogostemon cablin geraniol synthase (GS1) mRNA which is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate (GPP) can be produced. Then PcGES helps convert GPP to geraniol. | PcGES stands for Pogostemon cablin geraniol synthase (GS1) mRNA which is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate (GPP) can be produced. Then PcGES helps convert GPP to geraniol. | ||
Line 43: | Line 46: | ||
Pentapetalae; asterids; lamiids; Lamiales; Lamiaceae; Lamioideae; | Pentapetalae; asterids; lamiids; Lamiales; Lamiaceae; Lamioideae; | ||
Pogostemoneae; Pogostemon. | Pogostemoneae; Pogostemon. | ||
+ | https://static.igem.org/mediawiki/2017/c/c3/T--CIEI-BJ--part002--source.jpg | ||
Patchouli (Pogostemon cablin) is a species of plant from the genus Pogostemon. It is a bushy herb of the mint family, with erect stems, reaching around 75 centimetres (2.5 ft) in height and bearing small, pale pink-white flowers. The plant is native to tropical regions of Asia, and is now extensively cultivated in China, Indonesia, Cambodia, Myanmar, India, Maldives, Malaysia, Mauritius, Seychelles, Madagascar, Taiwan, Philippines, Thailand, Vietnam, South America and the Caribbean. | Patchouli (Pogostemon cablin) is a species of plant from the genus Pogostemon. It is a bushy herb of the mint family, with erect stems, reaching around 75 centimetres (2.5 ft) in height and bearing small, pale pink-white flowers. The plant is native to tropical regions of Asia, and is now extensively cultivated in China, Indonesia, Cambodia, Myanmar, India, Maldives, Malaysia, Mauritius, Seychelles, Madagascar, Taiwan, Philippines, Thailand, Vietnam, South America and the Caribbean. | ||
Line 48: | Line 52: | ||
===Experiments=== | ===Experiments=== | ||
− | In our experiments, due to the position of domain, we have to ligate F2A to the downstream of HbOYE by using bridge PCR. Then this integration is ligated to PcOYE to form a whole. The product is our part. | + | In our experiments, due to the position of domain, we have to ligate F2A to the downstream of HbOYE by using bridge PCR. Then this integration is ligated to PcOYE to form a whole. The product is our part. The diagram below shows the original pathway of citronellol production. However, by using our part, the last two steps will be combined together and the efficiency will be improved. |
+ | |||
+ | [[File:Mosquito_parts-figure1.png|center|940px|img]] | ||
Information about bridge PCR: In MAST (mRNA accessible site tagging), the DNA tags from synthesized library were employed for identifying mRNA accessible sites. A large number of tags were amplified and subcloned for sequencing to verify mRNA binding profiles. A PCR was designed by using one primer which bridges over the tag terminal sequences. In PCR reaction DNA tag fragments were concatemerized by a bridge primer in reaction cycles. | Information about bridge PCR: In MAST (mRNA accessible site tagging), the DNA tags from synthesized library were employed for identifying mRNA accessible sites. A large number of tags were amplified and subcloned for sequencing to verify mRNA binding profiles. A PCR was designed by using one primer which bridges over the tag terminal sequences. In PCR reaction DNA tag fragments were concatemerized by a bridge primer in reaction cycles. | ||
+ | |||
+ | [[File:Mosquito-bj-jiao4.png|center|380px|img]] | ||
+ | The part is successfully ligated into pSB1C3.The left column is the marker, and lane 1and lane2 on the right are PCR products of the HbOYE+P2A+PcGES. | ||
+ | |||
+ | Primer sequence- | ||
+ | |||
+ | NEB-HbOYE-F-EcoRI:TTTCGCTAAGGATGATTTCTGGATGGCTGAAACTGGAAC | ||
+ | |||
+ | NEB-HbOYE+2A+PcGES-R-PstI:ACCTTGCCCTTTTTTGCCGGACTCAAATAGAAGATGGCAA | ||
+ | |||
+ | |||
+ | [[File:Mosquito-bj-jiao2.png|center|940px|img]] | ||
+ | Fig 2 Th e SDS-PAGE electrophoresis of recombinant protein Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. Black arrow shows the targeted recombinant proteins. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours. | ||
+ | |||
+ | |||
+ | [[File:Mosquito-bj-jiao1.png|center|940px|img]] | ||
+ | Fig 3 Western blot result using HIS antibody. Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours; The first antibody used in Western blotting is Kangwei biocompany-CW0304S and the second antibody is Kangwei biocompany-CW0102S | ||
+ | |||
===Purpose for designing this part=== | ===Purpose for designing this part=== | ||
Line 74: | Line 98: | ||
REFERENCE 3 | REFERENCE 3 | ||
− | AUTHORS Mao, Jian Ping | + | AUTHORS Mao, Jian Ping |
− | TITLE Bridge PCR,An Easy Way for Concatemerizing DNA Tags | + | TITLE Bridge PCR,An Easy Way for Concatemerizing DNA Tags |
− | JOURNAL China Biotechnology (2009). | + | JOURNAL China Biotechnology (2009). |
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Latest revision as of 00:32, 2 November 2017
-HbOYE-F2A-PcGES-
HbOYE
LOCUS DQ004685
SIZE 1455 bp
DEFINITION Hevea brasiliensis 12-oxophytodienoate reductase (opr).
HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.
(More information about HbOYE is on the page of part BBa_K2281006)
F2A
F2A sequence: CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGGGCCC
2A, known as CHYSEL polypeptides, contains the peptide bond to grow the peptide chain which helps to link two genes. The presence of the conserved CHYSEL residues in the peptides (Donnelly et al., 1997; Ryan et al., 2002) contributes to form a torsion which causes the peptide chain to be released later (Ryan et al., 2002), and then the two genes can express in a cell separately.
SOURCE
The foot-and-mouth disease virus (FMDV) is the pathogen that causes foot-and-mouth disease. It is a picornavirus, the prototypical member of the Aphthovirus genus. The disease, which causes vesicles (blisters) in the mouth and feet of bovids, suids, ovids, caprids and other cloven-hoofed animals is highly infectious and a major plague of animal farming.
PcGES
LOCUS KF926075
SIZE 1734 bp
DEFINITION Pogostemon cablin geraniol synthase (GS1)
PcGES stands for Pogostemon cablin geraniol synthase (GS1) mRNA which is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate (GPP) can be produced. Then PcGES helps convert GPP to geraniol.
SOURCE Pogostemon cablin (patchouli)
ORGANISM Pogostemon cablin Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae; asterids; lamiids; Lamiales; Lamiaceae; Lamioideae; Pogostemoneae; Pogostemon.
Patchouli (Pogostemon cablin) is a species of plant from the genus Pogostemon. It is a bushy herb of the mint family, with erect stems, reaching around 75 centimetres (2.5 ft) in height and bearing small, pale pink-white flowers. The plant is native to tropical regions of Asia, and is now extensively cultivated in China, Indonesia, Cambodia, Myanmar, India, Maldives, Malaysia, Mauritius, Seychelles, Madagascar, Taiwan, Philippines, Thailand, Vietnam, South America and the Caribbean.
Experiments
In our experiments, due to the position of domain, we have to ligate F2A to the downstream of HbOYE by using bridge PCR. Then this integration is ligated to PcOYE to form a whole. The product is our part. The diagram below shows the original pathway of citronellol production. However, by using our part, the last two steps will be combined together and the efficiency will be improved.
Information about bridge PCR: In MAST (mRNA accessible site tagging), the DNA tags from synthesized library were employed for identifying mRNA accessible sites. A large number of tags were amplified and subcloned for sequencing to verify mRNA binding profiles. A PCR was designed by using one primer which bridges over the tag terminal sequences. In PCR reaction DNA tag fragments were concatemerized by a bridge primer in reaction cycles.
The part is successfully ligated into pSB1C3.The left column is the marker, and lane 1and lane2 on the right are PCR products of the HbOYE+P2A+PcGES.
Primer sequence-
NEB-HbOYE-F-EcoRI:TTTCGCTAAGGATGATTTCTGGATGGCTGAAACTGGAAC
NEB-HbOYE+2A+PcGES-R-PstI:ACCTTGCCCTTTTTTGCCGGACTCAAATAGAAGATGGCAA
Fig 2 Th e SDS-PAGE electrophoresis of recombinant protein Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. Black arrow shows the targeted recombinant proteins. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours.
Fig 3 Western blot result using HIS antibody. Lane M, protein marker; Lane 1, total protein with IPTG induction of HbOYE+F2A+PcGES-contained pET32a vector ; Lane 2, total protein with IPTG induction of HbOYE+P2A+PcGES-contained pET32a vector; Lane CK, protein produced by empty pET32a vector. The condition for protein induction is under 30℃ with the IPTG concentration of 0.4 mM for 3 hours; The first antibody used in Western blotting is Kangwei biocompany-CW0304S and the second antibody is Kangwei biocompany-CW0102S
Purpose for designing this part
The whole purpose of our project is to optimize the efficiency of producing citronellol, so as we combine GES and OYE with 2A, the productive efficiency will be achieved. As for this goal, this part is essential for our project. When functioning, since 2A functions as separating GES gene and OYE gene, which can be automatic removed by cell itself, two independent proteins can be synthesized properly throughout the process. Therefore, but only the final product will be same as before, but also the efficiency is improved.
References
REFERENCE 1 (bases 1 to 1734)
AUTHORS Ouyang,P., Zeng,S. and Mo,X. TITLE Cloning and Expression Analysis patchouli geraniol synthase Clone and Expression Analysis of Geraniol Synthase Gene in Pogostemon cablin JOURNAL Xibei Zhiwu Xuebao 36, 5 (2016)
REFERENCE 2 (bases 1 to 1734)
AUTHORS Ouyang,P. and Mo,X. TITLE Direct Submission JOURNAL Submitted (26-NOV-2013) Traditional Chinese Medicine, Guangdong Food and Grug Vocational College, Longdong North Road No. 321, Tianhe District, Guangzhou, Guangdong 510520, China
REFERENCE 3
AUTHORS Mao, Jian Ping TITLE Bridge PCR,An Easy Way for Concatemerizing DNA Tags JOURNAL China Biotechnology (2009).
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]