Difference between revisions of "Part:BBa K2212002"
Line 28: | Line 28: | ||
All three clones have the expected ~2.2kbp band | All three clones have the expected ~2.2kbp band | ||
[[Image:RafS gel.jpg|700px|center|thumb| '''Figure 2: Gel image of the validation of RafS.''']] | [[Image:RafS gel.jpg|700px|center|thumb| '''Figure 2: Gel image of the validation of RafS.''']] | ||
+ | |||
+ | ==Sequencing== | ||
+ | After gel validation, we sent one clone (clone #13, the first one from the left in the gel image above) for sequencing validation. The primers used were the same ones as used for PCR (Forward: 5'AGTCGGCCAATAACCCAGGGATTTCTTAGCTTTCGCTAAGGATGATTTCTG 3' Reverse: 5'GATTCTAGAAAGCTTCAAAAAGGCCACACCTTGCCCTTTTTTGCCGGA 3'). The alignment results are shown below. | ||
+ | [[Image:RafS sequencing 5'.png|700px|center|thumb| '''Figure 3: Sequencing validation for RafS insertion. 5' end.''']] | ||
+ | [[Image:RafS sequencing 3'.png|700px|center|thumb| '''Figure 4: Sequencing validation for RafS insertion. 3' end.''']] |
Latest revision as of 04:49, 29 October 2017
RafS w/ pconII+RiboswitchF+DYKDDDDK+rrnBT1
This part contains coding sequence for enzyme Raffinose synthase (EC 2.4.1.82), pconII promoter, riboswitch F, DYKDDDDK-tag, rrnB T1 terminator. The unlabeled sequences are random filler sequences. The protein sequence is originated from Arabidopsis thaliana. The protein coding sequence was codon optimized for Synechocystis sp. PCC 6803.
This part is intended to be used in Synechococcus elongatus PCC 7942 in the pathway for the production of tagatose from sucrose. Originally, this protein is an important enzyme in plant galactose metabolism pathway.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 410
Illegal BamHI site found at 1471
Illegal XhoI site found at 527 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 41
Illegal AgeI site found at 2020 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 564
Illegal BsaI.rc site found at 429
Gel Validation
Primers:
Forward: 5'AGTCGGCCAATAACCCAGGGATTTCTTAGCTTTCGCTAAGGATGATTTCTG 3'
Reverse: 5'GATTCTAGAAAGCTTCAAAAAGGCCACACCTTGCCCTTTTTTGCCGGA 3'
All three clones have the expected ~2.2kbp band
Sequencing
After gel validation, we sent one clone (clone #13, the first one from the left in the gel image above) for sequencing validation. The primers used were the same ones as used for PCR (Forward: 5'AGTCGGCCAATAACCCAGGGATTTCTTAGCTTTCGCTAAGGATGATTTCTG 3' Reverse: 5'GATTCTAGAAAGCTTCAAAAAGGCCACACCTTGCCCTTTTTTGCCGGA 3'). The alignment results are shown below.