Difference between revisions of "Part:BBa K2342007"

Latest revision as of 21:07, 31 October 2017

DCD1L peptide linked to a CBM with a 22 AA linker

This part comprises of a Dermcidin derived antimicrobial peptide DCD-1L linked to a Cellulose binding domain (CBM) with a 22 amino acid linker. Cellulose binding domain (CBM3), from Clostridium thermocellum, is used to immobilize DCD-1L on cellulose based materials. This part allows expression of DCD-1L antimicrobial peptide in form of a fusion protein accompanied with His6x-Smt3 tag on the N-terminus and CBM on C-terminus (6XHis-Smt3_DCD1L_22Linker_CBM) in E.coli without killing the host bacteria.

The construct can be purified using with commercially available and widely used affinity chromatography columns designed for His6x tag. Smt3 is tag is used to keep antimicrobial peptide, DCD1L, in inactive form by blocking its adhesion to phospholipid bilayer of the production host due to relatively large size of the tag. One major advantage of the fusion system used is that it facilitates easier detection of the peptide with a conventional method, SDS-PAGE. Also, SUMO tag is beneficial due to its effect on solubility of fusion peptide which significantly eases purification step. After purification, to cleave off His6x-Smt3 tag, Ulp1 enzyme that is known for its robust and specific proteolytic activity against SUMO fusion proteins, is used to obtain free DCD-1L-22 aa linker-CBM protein.

Preventing pathogen colonization on surfaces, is crucial to prevent spreading of infectious diseases. Therefore, immobilization of antimicrobial peptides can be a good alternative to other bactericidal agents because of their wide antimicrobial spectrum. For this purpose, we designed a construct containing a cellulose binding domain (CBM3), from Clostridium thermocellum, to immobilize DCD-1L on cellulose based materials. Our CBM constructs contain 22 amino acid long linker, to avoid interference with hexameric complex formation that leads cell death. Cellulose is a medically safe, eco-friendly, and abundant material, already present or can easily be incorporated in many applications. Furthermore, versatile nature of cellulosic materials from plastic-like hard materials to hydrogels expands application possibilities. Also, through alteration of the part by changing DCD-1L to another AMP in this expression system application range can be further increased.

Contents:

1. Biology and system

2. Small scale Production

2.1 Cultivations and Induction of protein expression

2.2 Purification

2.3 SDS-Page of protein purification

3 Large Scale Production (Half liter batch)

3.1 Cultivations and Induction

3.2 Cell Lysis and Purification

3.3 SDS-Page of protein purification

4. Concentration process and SDS PAGE

5. Ulp1 enzyme digestion and SDS PAGE

6. MALDI-TOF-TOF Analysis

7. CNF binding assay for CBM proteins

1. Biology

Dermcidin is an antimicrobial peptide (AMP) found in primates with no homology to other known AMPs (2). It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense (3). Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as DCD-1 and DCD-1L. DCD-1L is one of the most abundant form of dermcidin derived peptide. DCD-1L is a 48 amino acid long anionic peptide active against wide spectrum of bacteria including Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes (2,6). Although the precise mode of action is not entirely explored, it is thought that DCD-1L hexamers form pores on bacterial membrane leading to cell death (5).

Ulp1 enzyme, known for its robust and specific proteolytic activity against SUMO fusion proteins, is utilized to cleave of His6x-Smt3 tag is used for expression and purification (4). His6x tag in N-terminus is used for purification with immobilized metal ion affinity chromatography (IMAC) columns designed for histidine tagged proteins. Smt3 tag keeps antimicrobial peptide in inactivation form so that the peptide is not toxic to production host, by blocking its adhesion due to relatively large size of His-Smt3 tag. Smt3 tag Another advantage of using Smt3 is its effect on solubility and preventing inclusion bodies of fusion peptide which significantly eases purification step. Finally, it facilitated easier detection of the peptide with a conventional method like SDS-PAGE.

Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid.

Promoter information

The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual )

Figure 1. Plasmid map of our composite part (Geneious version 10.1.3 (http://www.geneious.com, Kearse et al., 2012)) (1)

Sequencing results

The sequence of the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct.

Figure 2. At the top: full alignment of the sequencing result with the cloned part in biobrick backbone pSB1C3-6xHis-Smt3-DCD-1L-22 aa linker-CBM. Below, sequencing result with the VF2 primer (BBa_G00100) and at the bottom, sequencing result with the VR primer (BBa_G00101). Generated using Geneious version 10.1.3 (http://www.geneious.com, Kearse et al., 2012)) (1)

2. Small scale Production

2.1 Cultivations and Induction of protein expression

For small scale production, 3-4 colonies from the transformation plates were inoculated (the expression strain cells https://www.neb.com/products/c2566-t7-express-competent-e-coli-high-efficiency) transformed with plasmids carrying the gene of interest) in 7 ml LB-kanamycin (50 μg/ml working concentration) and grew the cells at +37 °C until it reached the OD600 value ~0,51. When finished growing the cells, the expression of the gene of interest was induced by adding a final concentration of 0,5 mM IPTG in the cultures and continued to grow at +37 °C shaking.

2.2 Purification

4h after induction, the cells were pelleted by centrifuging at 12000 x g for 1 minute and discarded the supernatant. Then resuspended the pellet in 100 μl of ThermoFisher Scientific B-PER Bacterial Protein Extraction Reagent.

After equilibrating the Qiagen Ni-NTA spin columns with 600 μl of NPI-10 buffer (50 nM NaPi, 300 mM NaCl, pH 8,0) protein purification was done. The samples were loaded onto the spin columns and centrifuged at 1600 rpm for 5 minutes, followed by Washing the columns with 600 μl of NPI-20 buffer (50 mM NaPi, 300 mM NaCl, 30 mM imidazole, pH 8,0). The proteins were eluted in 300 μl of NPI-500 buffer (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). The samples from different flow throughs and elution were then analysed using SDS PAGE.

2.3 SDS-Page of protein purification

Following small scale protein expression Qiagen Ni-NTA spin columns are used for purification. From different steps of purification, such as washing and elution, samples are loaded on SDS-PAGE along with samples collected from the small scale expression culture.

SDS-PAGE image (Figure 3) shows that after induction of expression with IPTG, the band gets corresponding to gene of interest gets thicker gradually, from initial (well 1) to 4 hours (well 3). It proves that the T7 promoter system works as intended, without promoter leakage. Although, there is a strong band in both lysate(well 4) and pellet (well 5) suggesting that protein of interest was partially precipitated. Soluble portion of the protein in lysate can be seen in well 7 and 8.

Figure 3. SDS-Page image from small scale expression of His6x-Smt3-DCD1L-22 Linker-CBM construct (36.910 kDa) M: Marker (PageRuler™ Prestained Protein Ladder, Thermo Fisher) 1: Non-induced, 2: 2 hours of induction, 3: 4 hours of induction, 4: Lysate, 5: Pellet, 6: Flow through, 7: Eluate 1, 8: Eluate 2

3 Large Scale Production (Half liter batch)

3.1 Cultivations and Induction

Large scale protein expression was started by inoculating 3-10 single colonies (of the expression strain cells transformed with plasmids carrying the gene of interest) in 25mL of LB medium with the 50ug/ml Kanamycin and incubated at +30°C with shaking overnight. The next day we prewarmed 500 mL of LB medium to +37°C in a 2L Erlenmeyer flask and added 50 ug/ml Kanamycin. Then inoculated 3-5 mL of the overnight grown preculture in 500 mL prewarmed LB. Flask was incubated at +37°C with shaking until OD600 value reached 0.6.Protein expression was then induced with a final concentration of 0.5mM IPTG and incubated the culture at +37°C for 4 hours.

3.2 Cell Lysis and Purification

The 35 ml sample with harvested cells was then lysed using Emulsiflex machine and was injected into the ÄKTA Machine for protein purification using His tag affinity method was done the Fractions were collected. We Selected elution fractions (Figure 4) with the desired protein from the graph, and run flow-through and elution fractions on SDS-PAGE. Fractions that contain the desired protein were pooled, frozen in liquid nitrogen and stored at -20°C.

Figure 4. Sample Image of the plate with all the eluates from the Äkta machine after purification.

Figure 5. Curve obtained after purification using the Äkta machine. The blue peak represents the eluted proteins.

Wells (from A2 to B5) are selected based on the peaks from the graph (Figure 5) and analysed by running SDS-PAGE for protein of interest.

3.3 SDS-Page of protein purification

The molecular weight of His6x-DCD-1L-22 aa linker-CBM is 37.2kDa. After running the selected fractions on the gel (Figure 6), it could be seen that eluates A3, B3, C3, D3, A4, B4 and C4 had our desired protein. Hence these were collected for further protein concentration and buffer exchange step and rest eluates were discarded.

Figure 6. SDS-PAGE Gel for His6x-Smt3-DCD-22 aa linker-CBM 1. Eluate A2, 2.Eluate B2, 3.Eluate C2, 4. Eluate D2, 5. Eluate A3, 6. Eluate B3, 7. Eluate C3, 8. Eluate D3, 9. Eluate A4, 10. Eluate B4, 11. Eluate C4, 12. Eluate D4, 13. Eluate A5, 14. Eluate B5.

4. Concentration process and SDS PAGE

After pooling of the eluates it is important to concentrate the peptide samples. The protein is currently diluted in 20 ml of buffer. So the samples were concentrated using Sartorious VIVA SPIN 20 ultrafilter (Membrane: 5000 MWCO PES) and exchanged the buffer with Napi

5. Ulp1 enzyme digestion and SDS PAGE

For digesting His6x-Smt3-containing DCD-1l with Ulp1 to obtain free DCD-1L 0.5μL of Ulp1 protease was added to 50μL of the purified protein (concentrated in e.g. NaPi buffer). The suitable digestion time was determined by incubating the protein with Ulp1 for different time points and running them on an SDS-PAGE. We can see that 10 mins of incubation at RT is enough.

Figure 7. Digestion of His6x-Smt3-DCD-1L-22 aa linker-CBM with Ulp1. Samples on the gel are: 1. Ulp1 (control) 10. His6x-Smt3-DCD-1L-22 aa linker-CBM (undigested) 11. His6x-Smt3-DCD-1L-22 aa linker-CBM + Ulp1 (digested for 0 minutes) 12. His6x-Smt3-DCD-1L-22 aa linker-CBM + Ulp1 (digested for 5 minutes) 13. His6x-Smt3-DCD-1L-22 aa linker-CBM + Ulp1 (digested for 30 minutes). Undigested samples are highlighted with white boxes: His6x-Smt3-DCD-1L-22 aa linker-CBM 37.3kDa. The desired proteins after digestion are highlighted with red boxes: DCD-1L-22 aa linker-CBM 23.8kDa. The digested N-terminus containing the His6x-tag and the Smt3-tag (13.5kDa) is highlighted with black.

6. MALDI-TOF Analysis

The sample after Ulp1 digestion was analysed using mass spec to identify DCD-1L-22 aa linker-CBM. We use matrix-assisted laser desorption/ionization-time of flight/time of flight (MALDI-TOF-TOF) mass spectrometer (UltrafleXtreamTM Bruker, Aalto department of biotechnology and chemical technology facilities, Espoo, Finland) equipped with a 200-Hz smart-beam 1 laser (337 nm, 4 ns pulse) to identify masses of proteins/peptides. Data collection was carried out by operating the instrument in positive ion mode controlled by the flex software packaged (FlexControl, FlexAnalysis). 5,000 laser shots were accumulated per each spectrum in MS modes. Protein Calibration Standard mixture I, II.

Figure 9. Image of Mass spec. Theoretical mass: 23800 Da and Result obtained: 23724 Da

7. Cellulose Nano Fiber binding essay for CBM proteins

A straightforward measurement was carried out to see whether the proteins are folded correctly and do indeed bind to cellulose with CBM (Cellulose binding domain), and how well they bind to cellulose. We used 150 ug of CNF and varied the concentration of protein from 0.5 uM to 50 uM. On gel the samples were put together with prepared samples of the same protein solution without binding to CNF. Any bands that ‘disappeared’ have bound to CNF.

Efficacy of CBM binding of DCD-1L-22 aa linker-CBM

The efficacy of cellulose binding domain binding to a cellulose substrate was probed. First, the purified protein construct was cleaved with Ulp1 to cleave off the Smt3 tag coupled with subsequent heat inactivation of the enzyme. For the binding assay, concentrations of 5 µM to 50 µM of peptide in low salt buffer were incubated with 150 µg of cellulose nanoFibrils (CNF). Control samples of matching peptide concentrations were prepared without the addition of CNF. The total sample volume for both samples was 100 µl. The samples were mixed thoroughly and incubated at room temperature for 1 hour. The samples were then centrifuged for 10 min at 4000 g and the supernatant was extracted for SDS-PAGE analysis. Prepared SDS-PAGE samples were run in a 12% acrylamide gel and the gels were fixed and stained with Coomassie blue. For DCD-1L-22 aa linker-CBM we expect a band at 23.8 kDa. The difference in the DCD-1L-22 aa linker-CBM bands between samples containing 150 µg CNF and those with no added CNF should correspond to the amount of protein successfully bound to the cellulose substrate. The SDS-PAGE gels for varying protein concentrations have been presented in figure 10 (a, b, c). Based on the SDS-PAGE analysis, we can determine that the CBM linked to our fusion protein remains active and successfully binds to CNF.

Figure 10 (a). SDS-PAGE gels of CBM binding assay of DCD-1L-22 aa linker-CBM, Protein concentration of 5 µM to 10 µM

Figure 10 (b). SDS-PAGE gels of CBM binding assay of DCD-1L-22 aa linker-CBM, Protein concentration of 15 µM to 20 µM

Figure 10 (c). SDS-PAGE gels of CBM binding assay of DCD-1L-22 aa linker-CBM, Protein concentration of 30 µM to 40 µM. In all gels two replicates of samples without CNF and with 150 µg of CNF have been pipetted in adjacent gels. The band at 23.8 kDa corresponds to DCD-1L-22 aa linker-CBM

Figure R42. SDS-PAGE gels of CBM binding assay of DCD-1L-22 aa linker-CBM a.) Protein concentration of 5 µM to 10 µM b.) protein concentrations of 15 µM to 20 µM c.) protein concentrations of 30 µM to 40 µM. In all gels two replicates of samples without CNF and with 150 µg of CNF have been pipetted in adjacent gels. The band at 23.8 kDa corresponds to DCD-1L-22 aa linker-CBM.

From the images (Figure 10(a,b)) we can observe that our CBM binds to the CNF due to lack of bands in the lanes with CNF. As the concentration of peptides increase, we also observe the protein bands in wells with CNF (Figure 10(c)). This is because the CNF is saturated with high concentration of protein and there are many unbound proteins in the solution. We calculated approximately that 1 ug of CNF binds 0.49 µg of our protein.

One thing to note here is the presence of the strong band between 15 kDa and 20 kDa which is unidentified. Our initial suspicion regarding the unidentified band was that it corresponds to free CBM based on its molecular weight, since it is 17.4kD. However, this band is also present in wells with CNF meaning that this band can not contain CBM given that CBM bands are not seen due to CNF-CBM binding. Thus we conclude that it is not CBM.

Another possibility is that Ulp1 enzyme cleaves the construct at a position between the 22 linker leaving His6x-Smt3-DCD-1L - with molecular weight 18.3kDa- free from CBM. But we are unclear about it since we haven't observed this in any of our previous experiment gels and it will be further investigated with our modelling studies.

References

1)Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.Bioinformatics, 28(12), 1647-1649.

2)Schittek, B., Hipfel, R., Sauer, B., Bauer, J., Kalbacher, H., Stevanovic, S., Schirle, M., Schroeder, K., Blin, N., Meier, F. and Rassner, G & Rassner, G. (2001). Dermcidin: a novel human antibiotic peptide secreted by sweat glands. Nature immunology, 2(12).

3)Schittek, B. (2012). The multiple facets of dermcidin in cell survival and host defense. Journal of innate immunity, 4(4), 349-360.

4)Malakhov, M. P., Mattern, M. R., Malakhova, O. A., Drinker, M., Weeks, S. D., & Butt, T. R. (2004). SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins. Journal of structural and functional genomics, 5(1), 75-86.

5)Burian, M., & Schittek, B. (2015). The secrets of dermcidin action. International Journal of Medical Microbiology, 305(2), 283-286.

6) Nakano, T., Yoshino, T., Fujimura, T., Arai, S., Mukuno, A., Sato, N., & Katsuoka, K. (2015). Reduced expression of dermcidin, a peptide active against Propionibacterium acnes, in sweat of patients with acne vulgaris. Acta dermato-venereologica, 95(7), 783-786

Sequence and Features