Difference between revisions of "Part:BBa K2281006"

(Sources)
 
(43 intermediate revisions by 4 users not shown)
Line 4: Line 4:
  
 
===Introduction===
 
===Introduction===
LOCUS      DQ004685                1455 bp    mRNA    linear  PLN 17-APR-2007
 
DEFINITION  Hevea brasiliensis 12-oxophytodienoate reductase (opr) mRNA, complete cds.
 
  
HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the enzyme which bolsters the production of cireonellol.
+
https://static.igem.org/mediawiki/parts/8/8f/T--CIEI-China2017--parts--06.jpg
 +
 
 +
 
 +
LOCUS      DQ004685 
 +
           
 +
SIZE          1455 bp 
 +
 
 +
DEFINITION  Hevea brasiliensis 12-oxophytodienoate reductase (opr)
 +
 
 +
HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.
 +
 
 +
[[File:Mosquito_parts-figure1.png|center|940px|img]]
 +
 
 +
The diagram shows the complete pathway of the production of citronellol and OYE is emplyed in the final step of the process.
 +
 
 +
The sequence of forward primer (NEB-HbOYE-F-EcoRI) is: CGGAATTCATGGCTGAAACTGGAACAG
 +
 
 +
The sequence of reverse primer (NEB-HbOYE1-R-PstI) is: AACTGCAGTCAAAGGCGTGATCGTGGCT
  
 
===Sources===
 
===Sources===
 +
 
SOURCE      Hevea brasiliensis
 
SOURCE      Hevea brasiliensis
https://static.igem.org/mediawiki/2017/1/1f/Hevea_brasiliensis-source_2.png
+
 
 +
Hevea brasiliensis, the Pará rubber tree, sharinga tree, seringueira, or, most commonly, the rubber tree or rubber plant, is a tree belonging to the family Euphorbiaceae. It is the most economically important member of the genus Hevea because the milky latex extracted from the tree is the primary source of natural rubber.
  
 
   ORGANISM  Hevea brasiliensis
 
   ORGANISM  Hevea brasiliensis
Line 18: Line 35:
 
             Pentapetalae; rosids; fabids; Malpighiales; Euphorbiaceae;
 
             Pentapetalae; rosids; fabids; Malpighiales; Euphorbiaceae;
 
             Crotonoideae; Micrandreae; Hevea.
 
             Crotonoideae; Micrandreae; Hevea.
https://static.igem.org/mediawiki/2017/7/72/T--CIEI-BJ--Safety--fingure1.jpg
+
                                        https://static.igem.org/mediawiki/parts/6/67/T--CIEI-China2017--parts--62.jpg
 +
 
 +
H. brasiliensis is a tall deciduous tree growing to a height of up to 40 m (131 ft) in the wild, but cultivated trees are usually much smaller because drawing off the latex restricts the growth of the tree. The trunk is cylindrical and may have a swollen, bottle-shaped base. The bark is some shade of brown, and the inner bark oozes latex when damaged. The leaves have three leaflets and are spirally arranged. The inflorescence include separate male and female flowers. The flowers are pungent, creamy-yellow and have no petals. The fruit is a capsule that contains three large seeds; it opens explosively when ripe.
 +
                                          https://static.igem.org/mediawiki/parts/5/5d/T--CIEI-China2017--parts--61.jpg
  
 
===References===
 
===References===

Latest revision as of 04:00, 2 November 2017


--HbOYE--

Introduction

T--CIEI-China2017--parts--06.jpg


LOCUS DQ004685

SIZE 1455 bp

DEFINITION Hevea brasiliensis 12-oxophytodienoate reductase (opr)

HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.

img

The diagram shows the complete pathway of the production of citronellol and OYE is emplyed in the final step of the process.

The sequence of forward primer (NEB-HbOYE-F-EcoRI) is: CGGAATTCATGGCTGAAACTGGAACAG

The sequence of reverse primer (NEB-HbOYE1-R-PstI) is: AACTGCAGTCAAAGGCGTGATCGTGGCT

Sources

SOURCE Hevea brasiliensis

Hevea brasiliensis, the Pará rubber tree, sharinga tree, seringueira, or, most commonly, the rubber tree or rubber plant, is a tree belonging to the family Euphorbiaceae. It is the most economically important member of the genus Hevea because the milky latex extracted from the tree is the primary source of natural rubber.

 ORGANISM  Hevea brasiliensis
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
           Pentapetalae; rosids; fabids; Malpighiales; Euphorbiaceae;
           Crotonoideae; Micrandreae; Hevea.
                                       T--CIEI-China2017--parts--62.jpg

H. brasiliensis is a tall deciduous tree growing to a height of up to 40 m (131 ft) in the wild, but cultivated trees are usually much smaller because drawing off the latex restricts the growth of the tree. The trunk is cylindrical and may have a swollen, bottle-shaped base. The bark is some shade of brown, and the inner bark oozes latex when damaged. The leaves have three leaflets and are spirally arranged. The inflorescence include separate male and female flowers. The flowers are pungent, creamy-yellow and have no petals. The fruit is a capsule that contains three large seeds; it opens explosively when ripe.

                                          T--CIEI-China2017--parts--61.jpg

References

REFERENCE 1 (bases 1 to 1455)

 AUTHORS   Norton,G., Pappusamy,A., Yusof,F., Pujade-Renaud,V., Perkins,M.,
           Griffiths,D. and Jones,H.
 TITLE     Characterisation of recombinant Hevea brasiliensis allene oxide
           synthase: effects of cycloxygenase inhibitors, lipoxygenase
           inhibitors and salicylates on enzyme activity
 JOURNAL   Plant Physiol. Biochem. 45 (2), 129-138 (2007)
  PUBMED   17344058

REFERENCE 2 (bases 1 to 1455)

 AUTHORS   Norton,G., Arokiaraj,P., Yusof,F., Pujade-Renaud,V., Griffiths,D.
           and Jones,H.
 TITLE     Direct Submission
 JOURNAL   Submitted (12-APR-2005) Division of Biosciences, University of
           Hertfordshire, College Lane, Hatfield, Herts AL10 9AB, UK

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]