Difference between revisions of "Part:BBa K2350004:Design"
(→Design Notes) |
(→Design Notes) |
||
(5 intermediate revisions by the same user not shown) | |||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
+ | <h4>Primer</h4> | ||
+ | |||
+ | <ol> | ||
+ | <li>P0001 | ||
+ | 5' aattcgcggccgcttctagagttgacggctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa 3' | ||
+ | <li>P0002 | ||
+ | 5' agtatttctcctctttctctagtagctagcacaatacctaggactgagctagccgtcaactctagaagcggccgcg 3' | ||
+ | <li>P0003 | ||
+ | 5' tactagatgagtaatttttcccgaag 3' | ||
+ | <li>P0004 | ||
+ | 5' agatgagtaatttttcccgaag 3' | ||
+ | <li>P0005 | ||
+ | 5' ttaagtctattaaagcttgaccaggcatcaaataaaacga 3' | ||
+ | <li>P0006 | ||
+ | 5' tcgttttatttgatgcctggtcaagctttaatagacttaa 3' | ||
+ | <li>P0007 | ||
+ | 5' tgcagcggccgctactagtatataaacgcagaaaggccca 3' | ||
+ | <li>P0008 | ||
+ | 5' gcggccgctactagtatataaacgcagaaaggccca 3' | ||
+ | </ol> | ||
===Source=== | ===Source=== |
Latest revision as of 08:10, 24 October 2017
This part produces a part of nitrate channel protein from Synechocystis sp. PCC 6803
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1179
Illegal BamHI site found at 549 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
Primer
- P0001 5' aattcgcggccgcttctagagttgacggctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa 3'
- P0002 5' agtatttctcctctttctctagtagctagcacaatacctaggactgagctagccgtcaactctagaagcggccgcg 3'
- P0003 5' tactagatgagtaatttttcccgaag 3'
- P0004 5' agatgagtaatttttcccgaag 3'
- P0005 5' ttaagtctattaaagcttgaccaggcatcaaataaaacga 3'
- P0006 5' tcgttttatttgatgcctggtcaagctttaatagacttaa 3'
- P0007 5' tgcagcggccgctactagtatataaacgcagaaaggccca 3'
- P0008 5' gcggccgctactagtatataaacgcagaaaggccca 3'
Source
This part produces a part of nitrate channel protein from Synechocystis sp. PCC 6803 .
References
- Koropatkin NM1, Pakrasi HB, Smith TJ. Atomic structure of a nitrate-binding protein crucial for photosynthetic productivity. 2006 Jun 27;103(26):9820-5. Epub 2006 Jun 15.
- Ye Wang, Wenbin Li, Yaeesh Siddiqi, James R. Kinghorn, Shiela E. Unkles and Anthony D. M. Glass. Evidence for post-translational regulation of NrtA, the Aspergillus nidulans high-affinity nitrate transporter. DOI: 10.1111/j.1469-8137.2007.02135.x • Source: PubMed
- Alexova R, Haynes PA, Ferrari BC, Neilan BA. Comparative protein expression in different strains of the bloom-forming cyanobacterium Microcystis aeruginosa. 2011 Sep;10(9):M110.003749. doi: 10.1074/mcp.M110.003749. Epub 2011 May 24.
- Omata T, Ohmori M, Arai N, Ogawa T. Genetically engineered mutant of the cyanobacterium Synechococcus PCC 7942 defective in nitrate transport. Proc Natl Acad Sci U S A. 1989 Sep;86(17):6612-6.
- Naureen Akhtar, Eugenia Karabika, James R. Kinghorn, Anthony D.M. Glass, Shiela E. Unkles, and Duncan A. Rouch. High-affinity nitrate/nitrite transporters NrtA and NrtB of Aspergillus nidulans exhibit high specificity and different inhibitor sensitivity. Microbiology. 2015 Jul; 161(Pt 7): 1435–1446. doi: 10.1099/mic.0.000088
- James R. Kinghorn, Joan Sloan, Ghassan J. M. Kana'n, Edisio R. DaSilva, Duncan A. Rouch, and Shiela E. Unkles. Missense Mutations That Inactivate the Aspergillus nidulans nrtA Gene Encoding a High-Affinity Nitrate Transporter. Genetics. 2005 Mar; 169(3): 1369–1377. doi: 10.1534/genetics.104.036590
- Maeda S, Omata T. Substrate-binding lipoprotein of the cyanobacterium Synechococcus sp. strain PCC 7942 involved in the transport of nitrate and nitrite. J Biol Chem. 1997 Jan 31;272(5):3036-41.