Difference between revisions of "Part:BBa K2450201"
(→‎Usage and Biology)
 
(5 intermediate revisions by the same user not shown)
Line 17: Line 17:
 
TEV protease has a specific cleavage site of Glu-Asn-Leu-Tyr-Phe-Gln-(CUT)-Gly, which was inserted into our protein in a linker region between the DNA binding domain and the dimerisation domain. It is a direct replacement of seven amino acids in the middle of the linker region with the cleavage sequence, to minimise the perturbation on protein function.
 
TEV protease has a specific cleavage site of Glu-Asn-Leu-Tyr-Phe-Gln-(CUT)-Gly, which was inserted into our protein in a linker region between the DNA binding domain and the dimerisation domain. It is a direct replacement of seven amino acids in the middle of the linker region with the cleavage sequence, to minimise the perturbation on protein function.
  
−
[[File:Oxford_2017_modified_TetR_full.png|400px|thumb|left|Modified TetR]] On PyMOL, we identified the different domains of the TetR monomer, and identified a suitable linker for cleavage. On the image to the left, the DNA binding domain is coloured in blue, the dimerisation domain is pink, and the linker which has been modified is in grey. Structural biology was key to the design of our part, as we would otherwise have no idea where to insert our cleavable linker. We also considered how the dimer formed in the choice of linker, such as whether the linker would be occluded by dimer formation.
+
[[File:Oxford_2017_modified_TetR_full.png|300px|thumb|left|Modified TetR]]  
 +
 
 +
On PyMOL, we identified the different domains of the TetR monomer, and identified a suitable linker for cleavage. On the image to the left, the DNA binding domain is coloured in blue, the dimerisation domain is pink, and the linker which has been modified is in grey. Structural biology was key to the design of our part, as we would otherwise have no idea where to insert our cleavable linker. We also considered how the dimer formed in the choice of linker, such as whether the linker would be occluded by dimer formation.
  
 
This part was designed to be used with BBa_K2450301 however could be used in combination with any protein after a tet operator sequence, to give expression under the control of TEV protease production and TEV cleavage. This makes it a very versatile part.
 
This part was designed to be used with BBa_K2450301 however could be used in combination with any protein after a tet operator sequence, to give expression under the control of TEV protease production and TEV cleavage. This makes it a very versatile part.
  
 +
CFP is a variation on Green Fluorescent Protein.
  
 +
For more information on how this part was used in our project, please see our wiki: http://2017.igem.org/Team:Oxford
  
 +
===Experiments===
  
−
 
+
[[File:Oxford_C200expvector.png|300px|thumb|right|BBa_K2450201 in the pQE-60 expression vector]] To express our part, we inserted it into the pQE-60 expression vector using NcoI and BamHI restriction enzymes. We first used PCR to get our part from the biobrick vector using the following primers.
−
<b>Experiments</b>
+
−
 
+
−
[[File:Oxford_C200expvector.png|400px|thumb|right|BBa_K2450201 in the pQE-60 expression vector]] To express our part, we inserted it into the pQE-60 expression vector using NcoI and BamHI restriction enzymes. We first used PCR to get our part from the biobrick vector using the following primers.
+
  
 
fw: 5' TCGCGGCCGCTTCTCCATGGCCGGCATGTC 3'
 
fw: 5' TCGCGGCCGCTTCTCCATGGCCGGCATGTC 3'
 
rv: 5' CCGTATTAACCGGATCCTTAATGATGATGATGATG 3'
 
rv: 5' CCGTATTAACCGGATCCTTAATGATGATGATGATG 3'
  
−
 
+
This allowed us to express our part and characterise it.
  
  

Latest revision as of 22:59, 1 November 2017


TetR with TEV cleavage site and CFP tag

This part is a modified TetR repressor protein containing a cleavage site for TEV protease. It offers a new way of relieving repression of a DNA system. The cleavage site is located in the linker between the DNA binding domain and dimerisation domain of TetR. It also has a His-tag for easy purification in a nickel column. It is an improvement of a previous iGEM part.

The TetR repressor is only functional as a dimer. Each monomer has a DNA-binding domain and a dimerisation domain.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

TetR functions as a homodimer to bind tet operator sequences and prevent the association of RNA polymerase with its promoter. Each TetR monomer has a DNA binding domain and a dimerisation domain. The DNA binding domain is a helix-turn-helix motif that associates with a tet operator sequence (TCCCTATCAGTGATAGAGA). Our complementary part, BBa_K2450301, contains 2 repeats of this sequence - one for each monomer.

TEV protease has a specific cleavage site of Glu-Asn-Leu-Tyr-Phe-Gln-(CUT)-Gly, which was inserted into our protein in a linker region between the DNA binding domain and the dimerisation domain. It is a direct replacement of seven amino acids in the middle of the linker region with the cleavage sequence, to minimise the perturbation on protein function.

Modified TetR

On PyMOL, we identified the different domains of the TetR monomer, and identified a suitable linker for cleavage. On the image to the left, the DNA binding domain is coloured in blue, the dimerisation domain is pink, and the linker which has been modified is in grey. Structural biology was key to the design of our part, as we would otherwise have no idea where to insert our cleavable linker. We also considered how the dimer formed in the choice of linker, such as whether the linker would be occluded by dimer formation.

This part was designed to be used with BBa_K2450301 however could be used in combination with any protein after a tet operator sequence, to give expression under the control of TEV protease production and TEV cleavage. This makes it a very versatile part.

CFP is a variation on Green Fluorescent Protein.

For more information on how this part was used in our project, please see our wiki: http://2017.igem.org/Team:Oxford

Experiments

BBa_K2450201 in the pQE-60 expression vector
To express our part, we inserted it into the pQE-60 expression vector using NcoI and BamHI restriction enzymes. We first used PCR to get our part from the biobrick vector using the following primers.

fw: 5' TCGCGGCCGCTTCTCCATGGCCGGCATGTC 3' rv: 5' CCGTATTAACCGGATCCTTAATGATGATGATGATG 3'

This allowed us to express our part and characterise it.








References

Orth, P et al. Structural basis of gene regulation by the tetracycline inducible Tet repressor−operator system Nature Structural Biology 7, 215 - 219 (2000) doi:10.1038/73324

Ramos JL, Martínez-Bueno M, Molina-Henares AJ, et al. The TetR Family of Transcriptional Repressors. Microbiology and Molecular Biology Reviews. 2005;69(2):326-356. doi:10.1128/MMBR.69.2.326-356.2005.

Functional Parameters