Difference between revisions of "Part:BBa K2368027"
 
(13 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
 
<h1>Introduction</h1>
 
<h1>Introduction</h1>
−
<partinfo>BBa_K2368027 short</partinfo>
+
<p style="text-align: center"><partinfo>BBa_K2368027 short</partinfo></p>
 
<h3>General</h3>
 
<h3>General</h3>
−
<p>The original Pfus (BBa_K1154001) is 201bp long with three STE12 binding sites, and the STE12 is Pfus’s transcriptional activator in the endogenous GPCR pathways of yeast.</p>
+
<p>The original <i>P<sub>fus</sub></i>  (BBa_K1154001) is 249bp long with three Ste12 binding sites, and the Ste12 is the transcriptional activator of <i>P<sub>fus</sub></i> in the endogenous GPCR pathways of yeast.</p>
−
<p>In order to enhance the transcription initiation activity of the promoter, we add additional three binding sites(gatgaaacaaacatgaaacgtctgtaatttgaaaca) in the front of the promoter. And we add 5umol/L α pheromone to detect the modified promoter, and the result is shown in fig.2.</p>
+
<br />
−
<p>The intensity of modified promoter is about 1/2 of the wild type, which doesn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there are serious limitations in STE12 multimers identifying STE12 binding sites. So when we change the structure of Pfus, the steric hindrance of STE12 may increases and STE12 can't combine the promoter as smoothly as before.</p>  
+
<br />
 +
[[File:T_BIT-China_2017part_K2368026.png|center|500px|默认文字]]
 +
<p style="text-align: center">Fig.1 The sequence of original <i>P<sub>fus</sub></i> </p>
 +
<br />
 +
<br />
 +
<p>In order to enhance the transcription initiation activity of the promoter, we added additional three binding sites (gatgaaacaaacatgtct                      gtaatttgaaacacgcgctgtctca) in the front of the promoter. </p>
 +
[[File:T_BIT-China_2017part_K2368027-1.png|center|500px|默认文字]]
 +
<p style="text-align: center">Fig.2 Sequencing result of original <i>P<sub>fus</sub></i>  and mutant <i>P<sub>fus</sub></i> </p>
 +
<p>After the modified promoter assembling into the [http://2017.igem.org/Team:BIT-China/Project/#Detection detection circuit], we added 5umol/L α pheromone to detect it, and the result is shown in Fig.3.</p>
  
−
<p>But from another point of view, still, we get the new Pfus with different transcription initiation activity. </p>
+
[[File:T_BIT-China_2017part_7.png|center|500px|默认文字]]
−
<h3>Reference</h3>
+
<p style="text-align: center">Fig.3 The <i>mRFP</i> intensity of two kinds of promoters</p>
−
<p>[1] Su, T.-C., Tamarkina, E. and Sadowski, I. (2010), Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae. FEBS Journal, 277: 3235–3248. doi:10.1111/j.1742-4658.2010.07728.x</p>
+
<br />
 +
<br />
 +
<br />
 +
<p>The intensity of modified promoter was about 1/2 of the wild type, which didn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there were serious limitations in Ste12 multimers identifying Ste12 binding sites. So when we changed the structure of <i>P<sub>fus</sub></i> , the steric hindrance of Ste12 may increases and Ste12 couldn’t combine the promoter as smoothly as before.  </p>
 +
<br />
 +
<p>But from another point of view, still, we got the new <i>P<sub>fus</sub></i>  with different transcription initiation activity. With different promoters, we can apply them in the regulation subsystem according to various situations or wide-ranging needs.</p>
 +
<br />
 +
<br />
 +
<p>This part is an improvement of [https://parts.igem.org/Part:BBa_K1154001 BBa_K1154001] of 2013 RHIT team.</p>
 +
<br />
 +
<br />
 +
<br />
 +
<br />
 +
<br />
 +
<p>[1] Su, T.-C., Tamarkina, E. and Sadowski, I. (2010), Organizational constraints on Ste12 cis-elements for a pheromone response in <i>Saccharomyces cerevisiae</i>. FEBS Journal, 277: 3235–3248. doi:10.1111/j.1742-4658.2010.07728.x </p>
  
  
Line 23: Line 45:
 
===Functional Parameters===
 
===Functional Parameters===
  
−
<partinfo>BBa_K2368027 parameters</partinfo>
+
<partinfo>BBa_K2368027
−
<!-- -->
+

Latest revision as of 19:27, 26 October 2017

Introduction

Pfus(6 Ste12 binding sites)

General

The original Pfus (BBa_K1154001) is 249bp long with three Ste12 binding sites, and the Ste12 is the transcriptional activator of Pfus in the endogenous GPCR pathways of yeast.



默认文字

Fig.1 The sequence of original Pfus



In order to enhance the transcription initiation activity of the promoter, we added additional three binding sites (gatgaaacaaacatgtct gtaatttgaaacacgcgctgtctca) in the front of the promoter.

默认文字

Fig.2 Sequencing result of original Pfus and mutant Pfus

After the modified promoter assembling into the [http://2017.igem.org/Team:BIT-China/Project/#Detection detection circuit], we added 5umol/L α pheromone to detect it, and the result is shown in Fig.3.

默认文字

Fig.3 The mRFP intensity of two kinds of promoters




The intensity of modified promoter was about 1/2 of the wild type, which didn’t match with our expectation. According to Ting-Cheng Su’s[1] result, there were serious limitations in Ste12 multimers identifying Ste12 binding sites. So when we changed the structure of Pfus , the steric hindrance of Ste12 may increases and Ste12 couldn’t combine the promoter as smoothly as before.


But from another point of view, still, we got the new Pfus with different transcription initiation activity. With different promoters, we can apply them in the regulation subsystem according to various situations or wide-ranging needs.



This part is an improvement of BBa_K1154001 of 2013 RHIT team.






[1] Su, T.-C., Tamarkina, E. and Sadowski, I. (2010), Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae. FEBS Journal, 277: 3235–3248. doi:10.1111/j.1742-4658.2010.07728.x


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]