Difference between revisions of "Part:BBa K2273117"
| (One intermediate revision by the same user not shown) | |||
| Line 6: | Line 6: | ||
It codes for a beta-lactamase found in <i>Bacillus subtilis</i>. Yet there is not much known about the activity and activation of the beta-lactamase PenP in <i>B. subtilis</i>. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3] | It codes for a beta-lactamase found in <i>Bacillus subtilis</i>. Yet there is not much known about the activity and activation of the beta-lactamase PenP in <i>B. subtilis</i>. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3] | ||
PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. This enzyme also harbours a n-terminal signal peptide sequence and is most likely secreted and therefore localized outside of the cell. [http://www.uniprot.org/uniprot/P39824] | PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. This enzyme also harbours a n-terminal signal peptide sequence and is most likely secreted and therefore localized outside of the cell. [http://www.uniprot.org/uniprot/P39824] | ||
| − | To investigate the native localization of penP in <i>Bacillus subtilis</i> we fused the <i>penP</i> gene to the genetic sequence coding for superfold GFP (sfGFP). | + | To investigate the native localization of penP in <i>Bacillus subtilis</i> we fused the <i>penP</i> gene to the genetic sequence coding for superfold GFP (sfGFP) [BBa_K2273021]. |
This part features the RFC25 prefix and suffix to enable further translational fusions or promoter insertions upstream of the construct: | This part features the RFC25 prefix and suffix to enable further translational fusions or promoter insertions upstream of the construct: | ||
| Line 26: | Line 26: | ||
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in <i>Bacillus subtilis</i>. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous. | In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in <i>Bacillus subtilis</i>. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous. | ||
| + | |||
| + | References: | ||
| + | |||
| + | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4422635/ 1] C. Lee Ventola, MS (2015) The antibiotic resistance crisis: part 2: management strategies and new agents. Pharmacy and Therapeutics 40(5), 344–352 | ||
| + | [https://www.aerzteblatt.de/archiv/52563 2] www.aerzteblatt.de, visited 08/23/17 (5:34pm) | ||
| + | [http://www.who.int/mediacentre/factsheets/fs194/en/ 3] www.who.int, visited 09/04/17 (3:21pm) | ||
| + | [https://en.wikipedia.org/wiki/Β-lactam_antibiotic 4] https://en.wikipedia.org/wiki/Β-lactam_antibiotic, visited 10/27/17 (4:42pm) | ||
| + | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778/ 5] Leticia I. Llarrull, Mary Prorok, and Shahriar Mobashery (2010) Binding of the Gene Repressor BlaI to the bla Operon in Methicillin-Resistant Staphylococcus aureus. Biochemistry 49(37), 7975–7977 Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013) | ||
| + | [https://jbioleng.biomedcentral.com/articles/10.1186/1754-1611-7-29 6] The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7(29),[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684797/ 7] Toth, M., Antunes, N.T., Stewart, N.K., Frase, H., Bhattacharya, M., Smith, C. and Vakulenko, S. (2016) Class D β-lactamases do exist in Gram-positive bacteria. Nature Chemical Biology 12(1),9-14 | ||
Latest revision as of 03:54, 2 November 2017
superfold GFP~PenP fusion construct for localization studies
This gene is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. It codes for a beta-lactamase found in Bacillus subtilis. Yet there is not much known about the activity and activation of the beta-lactamase PenP in B. subtilis. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3] PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. This enzyme also harbours a n-terminal signal peptide sequence and is most likely secreted and therefore localized outside of the cell. [http://www.uniprot.org/uniprot/P39824] To investigate the native localization of penP in Bacillus subtilis we fused the penP gene to the genetic sequence coding for superfold GFP (sfGFP) [BBa_K2273021].
This part features the RFC25 prefix and suffix to enable further translational fusions or promoter insertions upstream of the construct:
| Prefix with | EcoRI, NotI, XbaI, RBS, spacer sequence, Start Codon and NgoMIV | GAATTCGCGGCCGCTTCTAGAAGGAGGTGTCAAAATGGCCGGC |
| Suffix with | AgeI, Stop Codon, SpeI, NotI and PstI | ACCGGTTAAACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red, AgeI and NgoMIV in orange)
Beta-Lactam Biosensor
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in Bacillus subtilis. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous.
References:
1 C. Lee Ventola, MS (2015) The antibiotic resistance crisis: part 2: management strategies and new agents. Pharmacy and Therapeutics 40(5), 344–352 2 www.aerzteblatt.de, visited 08/23/17 (5:34pm) [http://www.who.int/mediacentre/factsheets/fs194/en/ 3] www.who.int, visited 09/04/17 (3:21pm) 4 https://en.wikipedia.org/wiki/Β-lactam_antibiotic, visited 10/27/17 (4:42pm) 5 Leticia I. Llarrull, Mary Prorok, and Shahriar Mobashery (2010) Binding of the Gene Repressor BlaI to the bla Operon in Methicillin-Resistant Staphylococcus aureus. Biochemistry 49(37), 7975–7977 Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013) 6 The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7(29),7 Toth, M., Antunes, N.T., Stewart, N.K., Frase, H., Bhattacharya, M., Smith, C. and Vakulenko, S. (2016) Class D β-lactamases do exist in Gram-positive bacteria. Nature Chemical Biology 12(1),9-14
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]