Difference between revisions of "Part:BBa K2273115"
| (4 intermediate revisions by the same user not shown) | |||
| Line 4: | Line 4: | ||
This membrane anchor is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. | This membrane anchor is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. | ||
| − | The sequence encodes the C-terminal end of the <i>yhcR</i> gene found in the <i>Bacillus subtilis</i> W168 genome. YhcR is an extracellular endonuclease that processes RNA. Due to its C-terminal sequence it is anchored into the inner cell membrane by so-called sortases. The sortase YhcS is able to recognize the sorting motif in the YhcR protein (that is also localized at the C-terminus) and subsequently facilitates the attachment to the cell membrane. | + | The sequence encodes the C-terminal end of the <i>yhcR</i> gene found in the <i>Bacillus subtilis</i> W168 genome. YhcR is an extracellular endonuclease that processes RNA. Due to its C-terminal sequence it is anchored into the inner cell membrane by so-called sortases. The sortase YhcS is able to recognize the sorting motif in the YhcR protein (that is also localized at the C-terminus) and subsequently facilitates the attachment to the cell membrane. [Hoang Duc Nguyen, Trang Thi Phuong Phan and Wolfgang Schumann (2011) Analysis and application of Bacillus subtilis sortases to anchor recombinant proteins on the cell wall. <i>AMB Express</i> <b>(1:22)</b>: 1-11.] |
We chose this genetic sequence of the <i>yhcR</i> gene to create a cell wall anchor that enables the easy attachment of the enzyme BlaZ (a beta-lactamase found in <i>Staphylococcus aureus</i>) to the outer cell wall. To enable translational fusions, the RFC25 prefix and suffix have been added to the anchor sequence: | We chose this genetic sequence of the <i>yhcR</i> gene to create a cell wall anchor that enables the easy attachment of the enzyme BlaZ (a beta-lactamase found in <i>Staphylococcus aureus</i>) to the outer cell wall. To enable translational fusions, the RFC25 prefix and suffix have been added to the anchor sequence: | ||
<table> | <table> | ||
<tr> | <tr> | ||
<td width="70">Prefix with</td> | <td width="70">Prefix with</td> | ||
| − | <td width="200"><span style="color:blue">EcoRI</span>, <span style="color:green">NotI</span>, <span style="color:red">XbaI | + | <td width="200"><span style="color:blue">EcoRI</span>, <span style="color:green">NotI</span>, <span style="color:red">XbaI</span>, Start Codon and <span style="color:orange">NgoMIV</span></td> |
| − | <td><span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA | + | <td><span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>ATG<span style="color:orange">GCCGGC</span></td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| Line 23: | Line 23: | ||
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in <i>Bacillus subtilis</i>. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous. | In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in <i>Bacillus subtilis</i>. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous. | ||
| + | References: | ||
| + | |||
| + | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4422635/ 1] C. Lee Ventola, MS (2015) The antibiotic resistance crisis: part 2: management strategies and new agents. Pharmacy and Therapeutics 40(5), 344–352 | ||
| + | [https://www.aerzteblatt.de/archiv/52563 2] www.aerzteblatt.de, visited 08/23/17 (5:34pm) | ||
| + | [http://www.who.int/mediacentre/factsheets/fs194/en/ 3] www.who.int, visited 09/04/17 (3:21pm) | ||
| + | [https://en.wikipedia.org/wiki/Β-lactam_antibiotic 4] https://en.wikipedia.org/wiki/Β-lactam_antibiotic, visited 10/27/17 (4:42pm) | ||
| + | [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778/ 5] Leticia I. Llarrull, Mary Prorok, and Shahriar Mobashery (2010) Binding of the Gene Repressor BlaI to the bla Operon in Methicillin-Resistant Staphylococcus aureus. Biochemistry 49(37), 7975–7977 Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013) | ||
| + | [https://jbioleng.biomedcentral.com/articles/10.1186/1754-1611-7-29 6] The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7(29),[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684797/ 7] Toth, M., Antunes, N.T., Stewart, N.K., Frase, H., Bhattacharya, M., Smith, C. and Vakulenko, S. (2016) Class D β-lactamases do exist in Gram-positive bacteria. Nature Chemical Biology 12(1),9-14 | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
Latest revision as of 03:53, 2 November 2017
YhcR cell wall anchor derived from Bacillus subtilis
This membrane anchor is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. The sequence encodes the C-terminal end of the yhcR gene found in the Bacillus subtilis W168 genome. YhcR is an extracellular endonuclease that processes RNA. Due to its C-terminal sequence it is anchored into the inner cell membrane by so-called sortases. The sortase YhcS is able to recognize the sorting motif in the YhcR protein (that is also localized at the C-terminus) and subsequently facilitates the attachment to the cell membrane. [Hoang Duc Nguyen, Trang Thi Phuong Phan and Wolfgang Schumann (2011) Analysis and application of Bacillus subtilis sortases to anchor recombinant proteins on the cell wall. AMB Express (1:22): 1-11.] We chose this genetic sequence of the yhcR gene to create a cell wall anchor that enables the easy attachment of the enzyme BlaZ (a beta-lactamase found in Staphylococcus aureus) to the outer cell wall. To enable translational fusions, the RFC25 prefix and suffix have been added to the anchor sequence:
| Prefix with | EcoRI, NotI, XbaI, Start Codon and NgoMIV | GAATTCGCGGCCGCTTCTAGAATGGCCGGC |
| Suffix with | AgeI, Stop Codon, SpeI, NotI and PstI | ACCGGTTAAACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red, AgeI and NgoMIV in orange)
Beta-Lactam Biosensor
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in Bacillus subtilis. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous.
References:
1 C. Lee Ventola, MS (2015) The antibiotic resistance crisis: part 2: management strategies and new agents. Pharmacy and Therapeutics 40(5), 344–352 2 www.aerzteblatt.de, visited 08/23/17 (5:34pm) [http://www.who.int/mediacentre/factsheets/fs194/en/ 3] www.who.int, visited 09/04/17 (3:21pm) 4 https://en.wikipedia.org/wiki/Β-lactam_antibiotic, visited 10/27/17 (4:42pm) 5 Leticia I. Llarrull, Mary Prorok, and Shahriar Mobashery (2010) Binding of the Gene Repressor BlaI to the bla Operon in Methicillin-Resistant Staphylococcus aureus. Biochemistry 49(37), 7975–7977 Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013) 6 The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7(29),7 Toth, M., Antunes, N.T., Stewart, N.K., Frase, H., Bhattacharya, M., Smith, C. and Vakulenko, S. (2016) Class D β-lactamases do exist in Gram-positive bacteria. Nature Chemical Biology 12(1),9-14
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 153
Illegal BamHI site found at 168 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 124