Difference between revisions of "Part:BBa K2273109"
| (One intermediate revision by the same user not shown) | |||
| Line 21: | Line 21: | ||
</tr> | </tr> | ||
</table> | </table> | ||
| − | Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (<span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> are marked in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red | + | Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (<span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> are marked in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">AgeI</span> and <span style="color:orange">NgoMIV</span> in orange) |
| − | < | + | |
===Beta-Lactam Biosensor=== | ===Beta-Lactam Biosensor=== | ||
Latest revision as of 13:34, 3 October 2017
BlaZ Beta-Lactamase derived from Staphylococcus aureus N315
The blaZ gene is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
This part is a composite of the bla operon found in Staphylococcus aureus and encodes a beta-lactamase that is able to degrade beta-lactam antibiotics by targeting the beta-lactam ring structure. This enzyme is controlled by the promoter PblaZ. If the microorganism is exposed to beta-lactam antibiotics, a receptor, named blaR1 [1], senses the compound and transducer a signal into the cytoplasm. Subsequently, the BlaI repressor Protein is degraded and frees the PblaZ promoter. Following, the enzyme is transcribed and confers resistance to the antibiotic.
This part has been codon optimized for expression in Bacillus subtilis using the online tool provided by IDT DNA. A Ribosome Binding Site (AGGAGG) specific for translation in Bacillus subtilis has been added upstream of the gene followed by a seven nucleotide spacer. Further the part features the RFC25 prefix and suffix:
| Prefix with | EcoRI, NotI, XbaI, RBS, spacer sequence, Start Codon and NgoMIV | GAATTCGCGGCCGCTTCTAGAAGGAGGTGTCAAAATGGCCGGC |
| Suffix with | AgeI, Stop Codon, SpeI, NotI and PstI | ACCGGTTAAACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red, AgeI and NgoMIV in orange)
Beta-Lactam Biosensor
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in Bacillus subtilis. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 742