Difference between revisions of "Part:BBa K2254001"
(→‎Characterisation)
 
(2 intermediate revisions by the same user not shown)
Line 3: Line 3:
  
 
===Usage and Biology===
 
===Usage and Biology===
−
The toehold switch cloning tool is a part used by Hong Kong-CUHK 2017 team for convenient cloning and validation of toehold switch that detect specific sequence of RNA. After designing toehold switch in silico, user can insert the switch into the part by Eco31I digestion followed by ligation.  
+
The toehold trigger cloning tool is a part used by Hong Kong-CUHK 2017 team for convenient cloning and validation of toehold switch that detect specific sequence of RNA. After designing the trigger of a toehold switch in silico, user can insert the trigger into the part by Eco31I digestion followed by ligation.  
  
−
To obtain the toehold switch insert, user can mix 2 DNA oligos (about 60nt): one oligo contains forward toehold switch sequence with AGGG at 5’ end, and one oligo contains reverse complement toehold switch sequence with AGTA at 5’ end.
+
To obtain the trigger insert, user can mix 2 DNA oligos (about 60nt): one oligo contains forward trigger sequence with AGGG at 5’ end, and one oligo contains reverse complement trigger sequence with AGTA at 5’ end.
−
To allow convenient screening of correct clone, double digestion by Eco31I will remove the constitutive promoter (J23100), and insertion of switch will block the translation of mRFP, resulting colonies that don’t express mRFP, whereas ligation of single digested plasmid will give red colonies.  
+
To allow convenient screening of correct clone, double digestion by Eco31I will remove the GFP gerenrator (I20260), and insertion of trigger will result in colonies that don’t express GFP, whereas ligation of single digested plasmid will give GFP colonies.  
  
−
The toehold switch will be linked to a flexible linker (AACCTGGCGGCAGCGCAAAAG) followed by mRFP reporter (E1010) and a double terminator (B0015). The linker is used to separate the coding sequence in the toehold switch and the reporter to prevent interference of protein folding. When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene. Since an Xhoi site is present between the linker and the mRFP sequence, the reporter can be easily changed by restriction digestion followed by ligation.
+
When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene.
  
 
===The Part===
 
===The Part===
Line 14: Line 14:
  
 
<b>Experimental:</b>
 
<b>Experimental:</b>
−
<br />
 
−
Characterisation
 
−
<br />
 
  
 +
Restriction mapping by XhoI and PstI showed correct insertion of our cloning tool into respective backbones pSB1K3, Eco31I could also digest the switch and trigger cloning tool. Below shows the 1% agarose gel:
 +
<br>
 +
<center>"https://static.igem.org/mediawiki/parts/0/0b/CUHK_TSDGel2.jpg"</center>
 +
<br>
 +
We tested our toehold trigger cloning tool when constructing our SAT switch. We ordered a pair of 60nt oligoes when constructing trigger-expressing plasmid. The complementary oligoes were mixed to give dsDNA insert with sticky end. The dsDNA was then ligated to Eco31I digested plasmid. Ligation product was transformed to E. coli DH5a competent cells. Below showed the plate of E. coli cell transformed with SAT trigger-oligoes-ligation product viewed under blue light:
 +
<br>
 +
<center>"https://static.igem.org/mediawiki/parts/2/20/CUHK_TSDClone.jpg"</center>
 +
<br>
 +
We can observed that there were fluorescent colonies and non- fluorescent colonies on plate. The black arrows point to 3 non- fluorescent colonies. Since fluorescent colonies are probably resulted by self-ligated plasmid, we picked the non- fluorescent colonies to sequence. Sequencing result showed that the switch were successfully inserted. This proved that our tools worked as expected and provide a convenient way for construction of trigger-expressing plasmid.
 
<html>
 
<html>
  
Line 40: Line 46:
  
 
<!-- Uncomment this to enable Functional Parameter display -->
 
<!-- Uncomment this to enable Functional Parameter display -->
 +
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo> BBa_K2254001 parameters</partinfo>
 
<partinfo> BBa_K2254001 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 18:18, 29 October 2017

No part name specified with partinfo tag.

Usage and Biology

The toehold trigger cloning tool is a part used by Hong Kong-CUHK 2017 team for convenient cloning and validation of toehold switch that detect specific sequence of RNA. After designing the trigger of a toehold switch in silico, user can insert the trigger into the part by Eco31I digestion followed by ligation.

To obtain the trigger insert, user can mix 2 DNA oligos (about 60nt): one oligo contains forward trigger sequence with AGGG at 5’ end, and one oligo contains reverse complement trigger sequence with AGTA at 5’ end. To allow convenient screening of correct clone, double digestion by Eco31I will remove the GFP gerenrator (I20260), and insertion of trigger will result in colonies that don’t express GFP, whereas ligation of single digested plasmid will give GFP colonies.

When the toehold switch hairpin is linearized by its orthogonal trigger RNA, RBS will be exposed, allowing the translation of downstream mRFP reporter gene.

The Part

Characterisation

Experimental:

Restriction mapping by XhoI and PstI showed correct insertion of our cloning tool into respective backbones pSB1K3, Eco31I could also digest the switch and trigger cloning tool. Below shows the 1% agarose gel:

"CUHK_TSDGel2.jpg"


We tested our toehold trigger cloning tool when constructing our SAT switch. We ordered a pair of 60nt oligoes when constructing trigger-expressing plasmid. The complementary oligoes were mixed to give dsDNA insert with sticky end. The dsDNA was then ligated to Eco31I digested plasmid. Ligation product was transformed to E. coli DH5a competent cells. Below showed the plate of E. coli cell transformed with SAT trigger-oligoes-ligation product viewed under blue light:

"CUHK_TSDClone.jpg"


We can observed that there were fluorescent colonies and non- fluorescent colonies on plate. The black arrows point to 3 non- fluorescent colonies. Since fluorescent colonies are probably resulted by self-ligated plasmid, we picked the non- fluorescent colonies to sequence. Sequencing result showed that the switch were successfully inserted. This proved that our tools worked as expected and provide a convenient way for construction of trigger-expressing plasmid.




Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 39
    Illegal NheI site found at 62
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 27
    Illegal BsaI.rc site found at 738


Functional Parameters

No part name specified with partinfo tag.