Difference between revisions of "Part:BBa K2136016:Design"
(hid sequences)
 
(2 intermediate revisions by the same user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
This sequence was codon optimized to match Chlamydomonas reinhardtii codons
+
 
 
mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion  cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1].
 
mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion  cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1].
 +
 +
This sequence was codon optimized to match Chlamydomonas reinhardtii codons. Because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein translation.
 +
<!---
 +
So here are the changes that we made in the DNA sequence using the software GeneArt from Life Technologies:
  
  
 +
Before codon optimization:
 +
5'- atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaa
 +
gcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa -3'
  
 +
After codon optimization:
 +
5'-
 +
ATGGTGTCCAAGGGCGAGGAGGACAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCAGCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCATGTACGGCAGCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACCTGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGCCTCCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCAGCAGCGAGCGCATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGCGCCTGAAGCTGAAGGACGGCGGCCACTACGACGCCGAGGTGAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTGAACATCAAGCTGGACATCACCAGCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCTGAGGGCCGCCACAGCACCGGCGGCATGGACGAGCTGTACAAGTAA -3
 +
--->
 
===Source===
 
===Source===
  

Latest revision as of 01:31, 19 October 2016


Codon optimized mCherry for Chlamydomonas reinhardtii


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

mCherry is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1].

This sequence was codon optimized to match Chlamydomonas reinhardtii codons. Because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein translation.

Source

mCherry is one of several "second-generation" monomeric fluorescent proteins developed in Roger Tsien's laboratory at UCSD (cf., Nature Biotechnology 22, 1567 - 1572 (2004). PMID 15558047

References