Difference between revisions of "Part:BBa K1928001"

 
(3 intermediate revisions by the same user not shown)
Line 4: Line 4:
  
 
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b.
 
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b.
 +
 +
<br>
 +
<strong>Contribution</strong>
 +
<br>
 +
Group: Shenzhen_SFLS
 +
<br>
 +
Author: Mixiao Gui
 +
<br>
 +
Summary: We have submitted this sequence confirmed part to the iGEM Parts Registry.(http://2017.igem.org/Team:Shenzhen_SFLS/Contribution)
 +
<br>
 +
Uploads: The sequence of this submitted part: https://static.igem.org/mediawiki/2017/5/51/Sfls-sequencing-part-BBa_K1928001.gb
 +
<br>
  
  

Latest revision as of 01:35, 2 November 2017


toehold switch sensor to detect HCV 1b RNA

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b.


Contribution
Group: Shenzhen_SFLS
Author: Mixiao Gui
Summary: We have submitted this sequence confirmed part to the iGEM Parts Registry.(http://2017.igem.org/Team:Shenzhen_SFLS/Contribution)
Uploads: The sequence of this submitted part: https://static.igem.org/mediawiki/2017/5/51/Sfls-sequencing-part-BBa_K1928001.gb


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]