Difference between revisions of "Part:BBa K1875013"

 
(3 intermediate revisions by the same user not shown)
Line 4: Line 4:
 
Single Operator
 
Single Operator
 
   
 
   
The BostonU 2016 iGEM team set out to design a set of mutually orthogonal guide RNA (gRNA) expressing and guide RNA operator pairs that could activate the expression of a gene of interest. This part contains target sequence for g1 from BostonU’s Gemini Library (TCTGCCCGAAGTTTCGACGG). As figure 2 indicates, the introduction of the gRNA leads to a several fold increase in expression in comparison to the basal level without the gRNA. The matrix (figure 3) illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the guide operator vectors in our system . The results from this experiment show that there is no significant expression among off target pairs, demonstrating that there is no cross talk in Gemini.
+
The [http://2016.igem.org/Team:BostonU 2016 BostonU] iGEM team designed a set of mutually orthogonal guide RNA (gRNA) expression vectors and gRNA operator reporters that could activate the expression of a gene of interest. This part contains the gRNA operator target sequence for gRNA 1 from BostonU’s Gemini Library (5’-TCTGCCCGAAGTTTCGACGG-3’) (Part [https://parts.igem.org/Part:BBa_K1875005 BBa_K1875005]). The introduction of the gRNA leads to a significant fold increase in expression of the gene of interest in comparison to the basal level tested without the gRNA (figure 2). Figure 3 illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the gRNA operator reporters in the Gemini Library. These results show that there is no significant expression among off target gRNA and operator pairs, demonstrating that there is no cross talk in Gemini.
 +
 
  
 
[[File:T--BostonU--pGOP_circle_map.png|400px|thumb|left|Figure 1: gRNA operator reporter plasmid map]]
 
[[File:T--BostonU--pGOP_circle_map.png|400px|thumb|left|Figure 1: gRNA operator reporter plasmid map]]
Line 12: Line 13:
 
[[File:T--BostonU--Mutual_orthog.png|400px|thumb|left|Figure 3: Mutual Orthogonality among gRNA expression vectors and gRNA operator reporters in Gemini. The green diagonal down the matrix indicates that there is no significant off target gene expression.  Measured in arbitrary median fluorescence intensity.]]
 
[[File:T--BostonU--Mutual_orthog.png|400px|thumb|left|Figure 3: Mutual Orthogonality among gRNA expression vectors and gRNA operator reporters in Gemini. The green diagonal down the matrix indicates that there is no significant off target gene expression.  Measured in arbitrary median fluorescence intensity.]]
  
 
+
[[File:T--BostonU--ProjectDescription.png|400px|thumb|center|[http://2016.igem.org/Team:BostonU BostonU 2016] Project description]]
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
 
+
  
  

Latest revision as of 00:25, 19 October 2016

This operator, when paired with a guide RNA, expresses GFP

Single Operator

The [http://2016.igem.org/Team:BostonU 2016 BostonU] iGEM team designed a set of mutually orthogonal guide RNA (gRNA) expression vectors and gRNA operator reporters that could activate the expression of a gene of interest. This part contains the gRNA operator target sequence for gRNA 1 from BostonU’s Gemini Library (5’-TCTGCCCGAAGTTTCGACGG-3’) (Part BBa_K1875005). The introduction of the gRNA leads to a significant fold increase in expression of the gene of interest in comparison to the basal level tested without the gRNA (figure 2). Figure 3 illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the gRNA operator reporters in the Gemini Library. These results show that there is no significant expression among off target gRNA and operator pairs, demonstrating that there is no cross talk in Gemini.


Figure 1: gRNA operator reporter plasmid map
Figure 2: Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors


Figure 3: Mutual Orthogonality among gRNA expression vectors and gRNA operator reporters in Gemini. The green diagonal down the matrix indicates that there is no significant off target gene expression. Measured in arbitrary median fluorescence intensity.
[http://2016.igem.org/Team:BostonU BostonU 2016] Project description







Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 924
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]