Difference between revisions of "Part:BBa K2060000:Design"
(→Design Notes) |
|||
(5 intermediate revisions by the same user not shown) | |||
Line 14: | Line 14: | ||
<p>- The target sequence can be on either DNA strand. | <p>- The target sequence can be on either DNA strand. | ||
− | <p>From this program we identified the R1 guide sequence | + | <p>From this <a href="https://github.com/passdan/scriptdrop/blob/master/cas9_targeter.py">program</a>we identified the the following 'R1' guide sequence: <b>GGTGGGGTAACGGCTCACCA</b> |
− | <p>This was added to | + | <p>This guide sequence was added to the conserved DNA scaffold sequence that will interact with bacterial Cas9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT |
− | <p>This was synthesised as a single fragment and directly cloned into pSB1C3 using EcoRI and PstI. | + | <p>This was synthesised by <a href="https://www.idtdna.com/pages/products/genes/gblocks-gene-fragments">IDT gBlock</a> as a single fragment together with the biobrick Prefix and Suffix and directly cloned into pSB1C3 using EcoRI and PstI. |
+ | <img width=50% src=https://static.igem.org/mediawiki/2016/5/53/T--Cardiff_Wales--GuideR1.png> | ||
</html> | </html> | ||
===Source=== | ===Source=== | ||
− | E.coli 16S ribosomal RNA | + | <i>E.coli</i> 16S ribosomal RNA |
===References=== | ===References=== |
Latest revision as of 13:04, 19 October 2016
CRISPR-Cas9 guide RNA targeting to 16S RNA
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 48
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a bioinformatic toolfor the selection of appropriate guide RNAs from E.coli ribosomal 16S RNA that adhered to the following rules:
- The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3').
- The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM.
- The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA.
- The target sequence can be on either DNA strand.
From this programwe identified the the following 'R1' guide sequence: GGTGGGGTAACGGCTCACCA
This guide sequence was added to the conserved DNA scaffold sequence that will interact with bacterial Cas9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
This was synthesised by IDT gBlock as a single fragment together with the biobrick Prefix and Suffix and directly cloned into pSB1C3 using EcoRI and PstI.
Source
E.coli 16S ribosomal RNA