Difference between revisions of "Part:BBa K1875011"

 
(4 intermediate revisions by the same user not shown)
Line 5: Line 5:
 
Guide RNA g3 Expression Part
 
Guide RNA g3 Expression Part
  
This part can be used to express a guide RNA (gRNA) from BostonU 2016’s project Gemini. Specifically, this part expresses g3, a gRNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This sequence can be found in basic part BBa_K1875003.  
+
This basic part can be used to express a guide RNA (gRNA) from [http://2016.igem.org/Team:BostonU BostonU 2016’s project Gemini]. Specifically, this part expresses gRNA 3, the 20bp target sequence 5’-AATGAACCTATTCGTACCGT-3’. This sequence can be found in basic part [https://parts.igem.org/Part:BBa_K1875004 BBa_K1875004] and composite part [https://parts.igem.org/Part:BBa_K1875014 BBa_K1875014], an operator reporter from the Gemini Library.  
  
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid containing a minimal CMV (Part BBa_K1875000), a variant of the g3 sequence, and a GFP reporter (Part BBa_K1875003) and a plasmid expressing dCas9-VPRWe assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the gRNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3.
+
gRNA expression vectors were transiently transfected into HEK293FT cells with guide  to validate the functionality of this part. These vectors were co-transfected with dCas9-VPR and its paired gRNA operator reporters containing gRNA 3, a mini CMV ([https://parts.igem.org/Part:BBa_K1875000 BBa_K1875000]), a Kozak ([https://parts.igem.org/Part:BBa_K1875001 BBa_K1875001]), a GFP ([https://parts.igem.org/Part:BBa_K1875003 BBa_K1875003]), and a rabbit beta globin poly-A terminator ([https://parts.igem.org/Part:BBa_K1875002 BBa_K1875002]).  GFP fluorescence was assayed using flow cytometry to compare expression levels both with and without the gRNA expression vectors. Results indicated that there was low basal expression without gRNA 3 and a high level of expression with gRNA 3. The Gemini system was compared to a CMV from the registry (Part [https://parts.igem.org/Part:BBa_I712004 BBa_I712004]) to test its strength against a different promoter.  The parts containing gRNA 3 from the Gemini system were found to be stronger than the CMV.
  
 
[[File:T--BostonU--pGEX_circle_map.png|400px|thumb|left|gRNA expression vector plasmid map]][[File:T--BostonU--chosen_four_GFP.png|400px|thumb|center|Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors]]
 
[[File:T--BostonU--pGEX_circle_map.png|400px|thumb|left|gRNA expression vector plasmid map]][[File:T--BostonU--chosen_four_GFP.png|400px|thumb|center|Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors]]
 +
 +
[[File:T--BostonU--ProjectDescription.png|400px|thumb|left|BostonU 2016 Project description]][[File:T--BostonU--Bba I712004 Validation Part2.png|400px|thumb|center|[https://parts.igem.org/Part:BBa_I712004 CMV] vs Gemini operators]]
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
  
  

Latest revision as of 00:10, 19 October 2016

This part produces a guide RNA that pairs with an operator.


Guide RNA g3 Expression Part

This basic part can be used to express a guide RNA (gRNA) from [http://2016.igem.org/Team:BostonU BostonU 2016’s project Gemini]. Specifically, this part expresses gRNA 3, the 20bp target sequence 5’-AATGAACCTATTCGTACCGT-3’. This sequence can be found in basic part BBa_K1875004 and composite part BBa_K1875014, an operator reporter from the Gemini Library.

gRNA expression vectors were transiently transfected into HEK293FT cells with guide to validate the functionality of this part. These vectors were co-transfected with dCas9-VPR and its paired gRNA operator reporters containing gRNA 3, a mini CMV (BBa_K1875000), a Kozak (BBa_K1875001), a GFP (BBa_K1875003), and a rabbit beta globin poly-A terminator (BBa_K1875002). GFP fluorescence was assayed using flow cytometry to compare expression levels both with and without the gRNA expression vectors. Results indicated that there was low basal expression without gRNA 3 and a high level of expression with gRNA 3. The Gemini system was compared to a CMV from the registry (Part BBa_I712004) to test its strength against a different promoter. The parts containing gRNA 3 from the Gemini system were found to be stronger than the CMV.

gRNA expression vector plasmid map
Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors
BostonU 2016 Project description
CMV vs Gemini operators







Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]