Difference between revisions of "Part:BBa K1949060:Design"
(8 intermediate revisions by the same user not shown) | |||
Line 5: | Line 5: | ||
Native Prhl (<partinfo>BBa_R0071</partinfo>) | Native Prhl (<partinfo>BBa_R0071</partinfo>) | ||
− | + | tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttc | |
− | |||
− | + | Prhl (<partinfo>BBa_K1949060</partinfo>) | |
+ | |||
+ | tcctgtgaaatctggcagttaccgttagctttcgaattggcta<font color=#ff0000><b>T</b></font>aaagtgttc | ||
− | |||
− | |||
− | |||
− | |||
− | |||
===Materials and Methods=== | ===Materials and Methods=== | ||
Line 26: | Line 22: | ||
-Plasmids | -Plasmids | ||
− | + | =====I. Improved Prhl by Tokyo_Tech 2014 and rhlR assay===== | |
− | A. Pcon-rhlR- | + | A. Pcon--<i>rbs-rhlR-LVA</i>(<partinfo>BBa_C0071</partinfo>) (pSB6A1), Prhl(LR)(<partinfo>BBa_K1529310</partinfo>)-<i>rbs-gfp</i> (pSB3K3) |
− | B. Pcon-rhlR(<partinfo>BBa_C0171</partinfo>) (pSB6A1), Prhl(LR)-gfp (pSB3K3) | + | B. Pcon-<i>rbs-rhlR</i>(<partinfo>BBa_C0171</partinfo>) (pSB6A1), Prhl(LR)-<i>rbs-gfp</i> (pSB3K3) |
− | C. Pcon-rhlR- | + | C. Pcon-<i>rbs-rhlR-LVA</i> (pSB6A1), Prhl(RL)(<partinfo>BBa_K1529300</partinfo>)-<i>rbs-gfp</i> (pSB3K3) |
− | D. Pcon-rhlR (pSB6A1), Prhl(RL)-gfp (pSB3K3) | + | D. Pcon-<i>rbs-rhlR</i> (pSB6A1), Prhl(RL)-<i>rbs-gfp</i> (pSB3K3) |
− | E | + | E. pSB6A1, pSB3K3 …Nagative control |
− | + | ||
− | + | ||
=====II. Improvment the native Prhl===== | =====II. Improvment the native Prhl===== | ||
− | A. Prhl(<partinfo>BBa_R0071</partinfo>)-gfp (pSB3K3) | + | A. Prhl(<partinfo>BBa_R0071</partinfo>)-<i>rbs-gfp</i> (pSB3K3) |
− | B. Pcon-rhlR- | + | B. Pcon-<i>rbs-rhlR-LVA</i> (pSB6A1), Prhl(NM)(<partinfo>BBa_K1949060</partinfo>)-<i>rbs-gfp</i> (pSB3K3) |
− | C. Pcon-rhlR- | + | C. Pcon-<i>rbs-rhlR-LVA</i> (pSB6A1), Prhl(M)-<i>rbs-gfp</i> (pSB3K3) |
− | D. Pcon-rhlR- | + | D. Pcon-<i>rbs-rhlR-LVA</i> (pSB6A1), Prhl(WT)-<i>rbs-gfp</i> (pSB3K3) |
E. pSB6A1, pSB3K3 …Nagative control | E. pSB6A1, pSB3K3 …Nagative control | ||
Line 54: | Line 48: | ||
=====III. Comparison the improved Prhl by Tokyo_Tech 2014 to our original improved Prhl===== | =====III. Comparison the improved Prhl by Tokyo_Tech 2014 to our original improved Prhl===== | ||
− | A. Pcon-rhlR- | + | A. Pcon-<i>rbs-rhlR-LVA</i> (pSB6A1), Prhl(LR)-<i>rbs-gfp</i> (pSB3K3) |
− | B. Pcon-rhlR- | + | B. Pcon-<i>rbs-rhlR-LVA</i> (pSB6A1), Prhl(NM)-<i>rbs-gfp</i> (pSB3K3) |
− | C. Pcon-rhlR- | + | C. Pcon-<i>rbs-rhlR-LVA</i> (pSB6A1), Pcon-<i>rbs-gfp</i> (pSB3K3)…Positive control |
D. pSB6A1, pSB3K3…Negative control | D. pSB6A1, pSB3K3…Negative control | ||
Line 75: | Line 69: | ||
====Assay protocol==== | ====Assay protocol==== | ||
− | The following experiments | + | The following experiments are performed at 37℃ unless otherwise stated. |
− | =====I. Improved Prhl by | + | =====I. Improved Prhl by iGEM 2014 team Tokyo_Tech and rhlR assay====== |
1) Prepare overnight culture for each sample in 3mL LB medium AK with vigorous shaking. | 1) Prepare overnight culture for each sample in 3mL LB medium AK with vigorous shaking. | ||
Line 89: | Line 83: | ||
5) Incubate the samples for 4 h with vigorous shaking. | 5) Incubate the samples for 4 h with vigorous shaking. | ||
− | 6) Add 100 microL of the samples | + | 6) Add 100 microL of the samples to each well of a plate reader. |
− | 7) Measure | + | 7) Measure RFU of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength. |
8) Measure the turbidity at 600 nm. | 8) Measure the turbidity at 600 nm. | ||
+ | =====II. Improvement the wild type Prhl (BBa_R0071)===== | ||
− | + | 1) Introduce a point mutation to -10 region of Prhl(BBa_R0071) ‐ rbs ‐ gfp (pSB3K3) by inverse PCR using wild type Prhl(BBa_R0071) ‐ rbs ‐ gfp (pSB3K3) as a template and divergent primers. The sequences of the six forward premiers and of one reverse primer are shown below. | |
− | + | WT 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaaaagtgttctactagtagcg-3' | |
− | + | F-Mu1 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggntaaaaagtgttctactagtagcg-3' | |
− | F- | + | F-Mu2 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggcnaaaaagtgttctactagtagcg-3' |
− | F- | + | F-Mu3 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctnaaaagtgttctactagtagcg-3' |
− | F- | + | F-Mu4 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctanaaagtgttctactagtagcg-3' |
− | F- | + | F-Mu5 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaanaagtgttctactagtagcg-3' |
− | F- | + | F-Mu6 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaanagtgttctactagtagcg-3' |
− | + | R 5'-aattcgaaagctaacggtaactgcca-3' (5' phosphorylated) | |
− | + | 2) Prepare strains containing the pMu1~6 plasmids containing mutated Prhl ‐ rbs ‐ gfp (pSB3K3). | |
− | + | 3) Streak the transformants on an agar plate containing kanamycin (50 microg / mL) and incubate overnight. | |
− | + | ||
− | 3) Streak the transformants on an agar plate containing kanamycin (50 microg/ mL) and incubate overnight. | + | |
4) Pore the LB medium K at the extent of covering the surface of the agar, and collect the colonies with a spreader. Then, incubate them in 5 mL LB medium K for 16 h with vigorous shaking. | 4) Pore the LB medium K at the extent of covering the surface of the agar, and collect the colonies with a spreader. Then, incubate them in 5 mL LB medium K for 16 h with vigorous shaking. | ||
− | 5) Extract the plasmid, and introduce Prhl(mut) | + | 5) Extract the plasmid, and introduce Prhl(mut) ‐ rbs ‐ gfp (pSB3K3) and Pcon ‐ rbs ‐ rhlR -‐LVA to XL‐1 Blue. |
6) Pore 200 microL LB medium AK containing C4 (6 microM) in one well of a 96-well plate and inoculate one colony to the well. Incubate the plate for 16 h. | 6) Pore 200 microL LB medium AK containing C4 (6 microM) in one well of a 96-well plate and inoculate one colony to the well. Incubate the plate for 16 h. | ||
− | 7) Transfer 100 microL of the culture from the above samples to another plate that is suitable for fluorescence measurement. Measure | + | 7) Transfer 100 microL of the culture from the above samples to another plate that is suitable for fluorescence measurement. Measure RFU of GFP / Turbidity at 490 nm as an exciting wavelength and 525 nm as an emission wavelength as well as the turbidity at 600 nm. |
− | 8) Select mutants that have higher SN ratio than | + | 8) Select mutants that have higher SN ratio than wild type Prhl (BBa_R0071) and grow them in 3 mL LB medium AK overnight with vigorous shaking. |
9) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL). | 9) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL). | ||
Line 138: | Line 131: | ||
12) Incubate the samples for 4 h with vigorous shaking. | 12) Incubate the samples for 4 h with vigorous shaking. | ||
− | 13) Add 100 microL of the samples | + | 13) Add 100 microL of the samples to each well of a plate reader. |
− | 14) Measure | + | 14) Measure RFU of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength. |
15) Measure the turbidity at 600 nm. | 15) Measure the turbidity at 600 nm. | ||
− | + | =====III. Comparison the improved Prhl promoter by iGEM 2014 team Tokyo_Tech to our original improved Prhl promoter===== | |
− | =====III. Comparison the improved Prhl promoter by | + | |
1) Prepare overnight cultures for each sample in 3mL LB medium AK with vigorous shaking. | 1) Prepare overnight cultures for each sample in 3mL LB medium AK with vigorous shaking. | ||
Line 158: | Line 150: | ||
5) Incubate the samples for 4 h with vigorous shaking. | 5) Incubate the samples for 4 h with vigorous shaking. | ||
− | 6) Add 100 microL of the samples | + | 6) Add 100 microL of the samples to each well of a plate reader. |
− | 7) Measure | + | 7) Measure RFU of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength. |
8) Measure the turbidity at 600 nm. | 8) Measure the turbidity at 600 nm. | ||
− | + | ===Reference=== | |
(1) Gerardo Medina et al. (2003) Mechanism of Pseudomonas aeruginosa RhlR Transcriptional Regulation of the rhlAB Promoter. | (1) Gerardo Medina et al. (2003) Mechanism of Pseudomonas aeruginosa RhlR Transcriptional Regulation of the rhlAB Promoter. |
Latest revision as of 03:50, 22 October 2016
Design Notes
Native Prhl (BBa_R0071)
tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttc
Prhl (BBa_K1949060)
tcctgtgaaatctggcagttaccgttagctttcgaattggctaTaaagtgttc
Materials and Methods
Construction
-Strain
All the plasmids were prepared in XL1-Blue strain.
-Plasmids
I. Improved Prhl by Tokyo_Tech 2014 and rhlR assay
A. Pcon--rbs-rhlR-LVA(BBa_C0071) (pSB6A1), Prhl(LR)(BBa_K1529310)-rbs-gfp (pSB3K3)
B. Pcon-rbs-rhlR(BBa_C0171) (pSB6A1), Prhl(LR)-rbs-gfp (pSB3K3)
C. Pcon-rbs-rhlR-LVA (pSB6A1), Prhl(RL)(BBa_K1529300)-rbs-gfp (pSB3K3)
D. Pcon-rbs-rhlR (pSB6A1), Prhl(RL)-rbs-gfp (pSB3K3)
E. pSB6A1, pSB3K3 …Nagative control
II. Improvment the native Prhl
A. Prhl(BBa_R0071)-rbs-gfp (pSB3K3)
B. Pcon-rbs-rhlR-LVA (pSB6A1), Prhl(NM)(BBa_K1949060)-rbs-gfp (pSB3K3)
C. Pcon-rbs-rhlR-LVA (pSB6A1), Prhl(M)-rbs-gfp (pSB3K3)
D. Pcon-rbs-rhlR-LVA (pSB6A1), Prhl(WT)-rbs-gfp (pSB3K3)
E. pSB6A1, pSB3K3 …Nagative control
III. Comparison the improved Prhl by Tokyo_Tech 2014 to our original improved Prhl
A. Pcon-rbs-rhlR-LVA (pSB6A1), Prhl(LR)-rbs-gfp (pSB3K3)
B. Pcon-rbs-rhlR-LVA (pSB6A1), Prhl(NM)-rbs-gfp (pSB3K3)
C. Pcon-rbs-rhlR-LVA (pSB6A1), Pcon-rbs-gfp (pSB3K3)…Positive control
D. pSB6A1, pSB3K3…Negative control
-Medium
LB medium AK
LB medium containing ampicillin (50 microg/ mL) and kanamycin (50 microg/ mL)
LB medium K
LB medium containing kanamycin (50 microg/ mL)
Assay protocol
The following experiments are performed at 37℃ unless otherwise stated.
I. Improved Prhl by iGEM 2014 team Tokyo_Tech and rhlR assay=
1) Prepare overnight culture for each sample in 3mL LB medium AK with vigorous shaking.
2) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).
3) Incubate the fresh cultures for 1 h with vigorous shaking.
4) Add C4 or DMSO to each 500 microL sample at the final concentration 10 microM or 100 microM.
5) Incubate the samples for 4 h with vigorous shaking.
6) Add 100 microL of the samples to each well of a plate reader.
7) Measure RFU of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.
8) Measure the turbidity at 600 nm.
II. Improvement the wild type Prhl (BBa_R0071)
1) Introduce a point mutation to -10 region of Prhl(BBa_R0071) ‐ rbs ‐ gfp (pSB3K3) by inverse PCR using wild type Prhl(BBa_R0071) ‐ rbs ‐ gfp (pSB3K3) as a template and divergent primers. The sequences of the six forward premiers and of one reverse primer are shown below.
WT 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaaaagtgttctactagtagcg-3'
F-Mu1 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggntaaaaagtgttctactagtagcg-3'
F-Mu2 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggcnaaaaagtgttctactagtagcg-3'
F-Mu3 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctnaaaagtgttctactagtagcg-3'
F-Mu4 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctanaaagtgttctactagtagcg-3'
F-Mu5 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaanaagtgttctactagtagcg-3'
F-Mu6 5'-tcctgtgaaatctggcagttaccgttagctttcgaatt ggctaaanagtgttctactagtagcg-3'
R 5'-aattcgaaagctaacggtaactgcca-3' (5' phosphorylated)
2) Prepare strains containing the pMu1~6 plasmids containing mutated Prhl ‐ rbs ‐ gfp (pSB3K3).
3) Streak the transformants on an agar plate containing kanamycin (50 microg / mL) and incubate overnight.
4) Pore the LB medium K at the extent of covering the surface of the agar, and collect the colonies with a spreader. Then, incubate them in 5 mL LB medium K for 16 h with vigorous shaking.
5) Extract the plasmid, and introduce Prhl(mut) ‐ rbs ‐ gfp (pSB3K3) and Pcon ‐ rbs ‐ rhlR -‐LVA to XL‐1 Blue.
6) Pore 200 microL LB medium AK containing C4 (6 microM) in one well of a 96-well plate and inoculate one colony to the well. Incubate the plate for 16 h.
7) Transfer 100 microL of the culture from the above samples to another plate that is suitable for fluorescence measurement. Measure RFU of GFP / Turbidity at 490 nm as an exciting wavelength and 525 nm as an emission wavelength as well as the turbidity at 600 nm.
8) Select mutants that have higher SN ratio than wild type Prhl (BBa_R0071) and grow them in 3 mL LB medium AK overnight with vigorous shaking.
9) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).
10) Incubate the fresh cultures for 1 h with vigorous shaking.
11) Add C4, C12 or DMSO to each 500 microL sample at the final concentration 10 microM.
12) Incubate the samples for 4 h with vigorous shaking.
13) Add 100 microL of the samples to each well of a plate reader.
14) Measure RFU of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.
15) Measure the turbidity at 600 nm.
III. Comparison the improved Prhl promoter by iGEM 2014 team Tokyo_Tech to our original improved Prhl promoter
1) Prepare overnight cultures for each sample in 3mL LB medium AK with vigorous shaking.
2) Dilute the overnight cultures to 1 / 60 in fresh LB medium AK (1.2 mL).
3) Incubate the fresh cultures for 1 h with vigorous shaking.
4) Add C4, C12 or DMSO to each 500 microL sample at the final concentration 10 microM.
5) Incubate the samples for 4 h with vigorous shaking.
6) Add 100 microL of the samples to each well of a plate reader.
7) Measure RFU of GFP at 490 nm as an exciting wavelength, 525 nm as a measurement wavelength.
8) Measure the turbidity at 600 nm.
Reference
(1) Gerardo Medina et al. (2003) Mechanism of Pseudomonas aeruginosa RhlR Transcriptional Regulation of the rhlAB Promoter. BACTERIOLOGY 185: 5976-5983
(2) John S. Chuang et al. (2009) Simpson’s Paradox in a Synthetic Microbial System. SCIENCE 323: 272-275