Difference between revisions of "Part:BBa K1937009:Design"
 
(8 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 +
=<b>Part: BBa_K1937009 (Epsilon/MazF)</b>=
 +
<br>
 +
(Chassis <i>E. coli</i>, carrier plasmid pSB1C3, part destined for use in <i>Bacillus subtilis</i>)
 +
Length: 1047 bp<br>
  
−
__NOTOC__
+
<b>Background:</b>
−
<partinfo>BBa_K1937009 short</partinfo>
+
This Epsilon/MazF part is one of the two components of a double toxin-antitoxin system. The gene Epsilon codes for a toxin countered by the anti-toxin Zeta (Zielenkiewicz and Cegłowski, 2005 ; Mutschler et al., 2011). The gene MazF encodes the anti-toxin for the MazE toxin (Bravo et al., 1987, Zhang et al., 2005, Wang et al., 2013). The part was designed to be carried on a plasmid while its counterpart MazE/Zeta was carried on another. Unfortunately, only Epsilon/MazF part was successfully cloned in <i>E. coli</i>.
 +
This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France)
 +
<br>
 +
<br>
 +
<b>This part:</b>
 +
<br>
 +
Epsilon and MazF are under the control of the promoter pVeg (constitutive promotor for <i>B. subtilis</i>) followed by a strong RBS. A theophylline-dependent riboswitch was used to prevent the MazE toxin expression during the cloning steps in presence of theophylline (Topp and Gallivan, 2008). Indeed, with an expressed toxin, it would be impossible to clone the Biobrick in <i>E. coli</i>. SacII and SalI are the restriction sites placed respectively before and after the riboswitch so that this fragment can easily be replaced depending on the control we want to apply to the bacteria.
 +
<br>
 +
[[File:BBa K193709-description.png ]]
 +
<br>
 +
<b>Validation:</b>
 +
This part was subcloned in the plasmid pSB<sub>Bs</sub>0K-Mini (BBa_K1937001) to be tested in <i>Bacillus subtilis</i> (BBa_K19370010). In absence of its counterpart MazE/Epsilon, it was not possible to validate this part. Besides, we did not obtain any transformant for this construction, with or without theophylline. We conclude that the toxicity of the operon is likely not controlled enough. <br>
  
−
<partinfo>BBa_K1937009 SequenceAndFeatures</partinfo>
 
  
  
−
===Design Notes===
+
<br>
−
Epsilon and MazF are under the control of the promoter Pveg (constitutive promotor for B. subtilis) followed by a strong RBS. A theophylline-dependent riboswitch was used to prevent the MazE toxin expression during the cloning steps in presence of theophylline (Topp and Gallivan, 2008). Indeed, with an expressed toxin, it would be impossible to clone the Biobrick in E. coli.SacII and SalI are the restriction sites placed respectively before and after the riboswitch so that this fragment can easily be replaced depending on the control we want to apply to the bacteria.
+
  
 +
=<b>Sequence:</b>=
  
 +
<html>
  
−
===Source===
+
<style>
  
−
The gene Epsilon codes for a toxin countered by the anti-toxin Zeta (Zielenkiewicz and Ceg&#322;owski, 2005 ; Mutschler et al., 2011). The gene MazF encodes the anti-toxin for the MazE toxin (Bravo et al., 1987, Zhang et al., 2005, Wang et al., 2013).
+
/*LAYOUT */
 +
.column  {
 +
padding: 10px 0px;
 +
float:left;  
 +
background-color:white;
 +
}
  
−
===References===
+
.full_size {
−
Bravo A, de Torrontegui G, and Díaz R (1987). Identification of components of a new stability system of plasmid R1, ParD, that is close to the origin of replication of this plasmid. Mol. Gen. Genet. 210: 101–110.  
+
width:100%;
−
Mutschler H, Gebhardt M, Shoeman RL, and Meinhart A (2011). A novel mechanism of programmed cell death in bacteria by toxin-antitoxin systems corrupts peptidoglycan synthesis. PLoS Biol. 9, e1001033.  
+
word-wrap: break-word;
−
Topp S. and Gallivan JP (2008). Riboswitches in unexpected places—A synthetic riboswitch in a protein coding region. RNA 14: 2498–2503.  
+
}
−
Wang X, Lord DM, Hong SH, Peti W, Benedik MJ, Page R, and Wood TK (2013). Type II Toxin/Antitoxin MqsR/MqsA Controls Type V Toxin/Antitoxin GhoT/GhoS. Environ. Microbiol.15: 1734–1744.  
+
 
−
Zhang Y, Zhang J, Hara H, Kato I, and Inouye M. (2005). Insights into the mRNA Cleavage Mechanism by MazF, an mRNA Interferase. J. Biol. Chem. 280: 3143–3150.  
+
 
−
Zielenkiewicz U and Cegłowski P (2005). The Toxin-Antitoxin System of the Streptococcal Plasmid pSM19035. J. Bacteriol. 187: 6094–6105.
+
 
 +
</style>
 +
 
 +
<div class="column full_size" style="font-size:10px;">
 +
ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagtaaaggtggtgaaatggcagttacgtatgaaaaaacatttgaaatagagatcattaacgaattatcggcaagcgtttataatcgagtattaaactatgttttgaaccatgaattaaataaaaatgactctcaattattggaagtcaatttattaaaccaattaaagcttgcaaaacgtgtaaatctttttgattattctttagaagaattacaagccgttcatgagtattggcggtcaatgaatcgttactcaaaacaagttttgaataaagagaaagtggcttaaccgcggatgcaacctgataccagcatcgtcttgatgcccttggcagcaggcaacaagggtaccatggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagtatcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaactcattaaagccaaaattaacgtactgattgggtaataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc<br><br>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
</div>
 +
 
 +
</html>
 +
 
 +
<b>Annotation:</b><br>
 +
Antitoxin Epsilon: 250-522 (Forward)<br>
 +
Pveg: 1-237 (Forward)<br>
 +
RBS Antitoxin: 238-249 (forward)<br>
 +
RBS Toxin: 570-579 (forward)<br>
 +
Riboswitch: 529-579 (forward)<br>
 +
Terminator: 925-1004 (forward)<br>
 +
Toxin mazF: 586-924 (forward)<br>
 +
 
 +
 
 +
<br><br>
 +
 
 +
=<b>References:</b>=
 +
<br>
 +
Bravo A, de Torrontegui G, and Díaz R (1987). Identification of components of a new stability system of plasmid R1, ParD, that is close to the origin of replication of this plasmid. Mol. Gen. Genet. 210: 101–110. <br>
 +
Mutschler H, Gebhardt M, Shoeman RL, and Meinhart A (2011). A novel mechanism of programmed cell death in bacteria by toxin-antitoxin systems corrupts peptidoglycan synthesis. PLoS Biol. 9, e1001033. <br>
 +
Topp S. and Gallivan JP (2008). Riboswitches in unexpected places—A synthetic riboswitch in a protein coding region. RNA 14: 2498–2503. <br>
 +
Wang X, Lord DM, Hong SH, Peti W, Benedik MJ, Page R, and Wood TK (2013). Type II Toxin/Antitoxin MqsR/MqsA Controls Type V Toxin/Antitoxin GhoT/GhoS. Environ. Microbiol. 15: 1734–1744. <br>
 +
Zhang Y, Zhang J, Hara H, Kato I, and Inouye M. (2005). Insights into the mRNA Cleavage Mechanism by MazF, an mRNA Interferase. J. Biol. Chem. 280: 3143–3150. <br>
 +
Zielenkiewicz U and Cegłowski P (2005). The Toxin-Antitoxin System of the Streptococcal Plasmid pSM19035. J. Bacteriol. 187: 6094–6105.<br>

Latest revision as of 17:47, 18 October 2016

Part: BBa_K1937009 (Epsilon/MazF)


(Chassis E. coli, carrier plasmid pSB1C3, part destined for use in Bacillus subtilis) Length: 1047 bp

Background: This Epsilon/MazF part is one of the two components of a double toxin-antitoxin system. The gene Epsilon codes for a toxin countered by the anti-toxin Zeta (Zielenkiewicz and Cegłowski, 2005 ; Mutschler et al., 2011). The gene MazF encodes the anti-toxin for the MazE toxin (Bravo et al., 1987, Zhang et al., 2005, Wang et al., 2013). The part was designed to be carried on a plasmid while its counterpart MazE/Zeta was carried on another. Unfortunately, only Epsilon/MazF part was successfully cloned in E. coli. This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France)

This part:
Epsilon and MazF are under the control of the promoter pVeg (constitutive promotor for B. subtilis) followed by a strong RBS. A theophylline-dependent riboswitch was used to prevent the MazE toxin expression during the cloning steps in presence of theophylline (Topp and Gallivan, 2008). Indeed, with an expressed toxin, it would be impossible to clone the Biobrick in E. coli. SacII and SalI are the restriction sites placed respectively before and after the riboswitch so that this fragment can easily be replaced depending on the control we want to apply to the bacteria.
BBa K193709-description.png
Validation: This part was subcloned in the plasmid pSBBs0K-Mini (BBa_K1937001) to be tested in Bacillus subtilis (BBa_K19370010). In absence of its counterpart MazE/Epsilon, it was not possible to validate this part. Besides, we did not obtain any transformant for this construction, with or without theophylline. We conclude that the toxicity of the operon is likely not controlled enough.



Sequence:

ggagttctgagaattggtatgccttataagtccaattaacagttgaaaacctgcataggagagctatgcgggttttttattttacataatgatacataatttaccgaaacttgcggaacataattgaggaatcatagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgtagtaaaggtggtgaaatggcagttacgtatgaaaaaacatttgaaatagagatcattaacgaattatcggcaagcgtttataatcgagtattaaactatgttttgaaccatgaattaaataaaaatgactctcaattattggaagtcaatttattaaaccaattaaagcttgcaaaacgtgtaaatctttttgattattctttagaagaattacaagccgttcatgagtattggcggtcaatgaatcgttactcaaaacaagttttgaataaagagaaagtggcttaaccgcggatgcaacctgataccagcatcgtcttgatgcccttggcagcaggcaacaagggtaccatggtaagccgatacgtacccgatatgggcgatctgatttgggttgattttgacccgacaaaaggtagcgagcaagctggacatcgtccagctgttgtcctgagtcctttcatgtacaacaacaaaacaggtatgtgtctgtgtgttccttgtacaacgcaatcaaaaggatatccgttcgaagttgttttatccggtcaggaacgtgatggcgtagcgttagctgatcaggtaaaaagtatcgcctggcgggcaagaggagcaacgaagaaaggaacagttgccccagaggaattacaactcattaaagccaaaattaacgtactgattgggtaataaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc

Annotation:
Antitoxin Epsilon: 250-522 (Forward)
Pveg: 1-237 (Forward)
RBS Antitoxin: 238-249 (forward)
RBS Toxin: 570-579 (forward)
Riboswitch: 529-579 (forward)
Terminator: 925-1004 (forward)
Toxin mazF: 586-924 (forward)




References:


Bravo A, de Torrontegui G, and Díaz R (1987). Identification of components of a new stability system of plasmid R1, ParD, that is close to the origin of replication of this plasmid. Mol. Gen. Genet. 210: 101–110.
Mutschler H, Gebhardt M, Shoeman RL, and Meinhart A (2011). A novel mechanism of programmed cell death in bacteria by toxin-antitoxin systems corrupts peptidoglycan synthesis. PLoS Biol. 9, e1001033.
Topp S. and Gallivan JP (2008). Riboswitches in unexpected places—A synthetic riboswitch in a protein coding region. RNA 14: 2498–2503.
Wang X, Lord DM, Hong SH, Peti W, Benedik MJ, Page R, and Wood TK (2013). Type II Toxin/Antitoxin MqsR/MqsA Controls Type V Toxin/Antitoxin GhoT/GhoS. Environ. Microbiol. 15: 1734–1744.
Zhang Y, Zhang J, Hara H, Kato I, and Inouye M. (2005). Insights into the mRNA Cleavage Mechanism by MazF, an mRNA Interferase. J. Biol. Chem. 280: 3143–3150.
Zielenkiewicz U and Cegłowski P (2005). The Toxin-Antitoxin System of the Streptococcal Plasmid pSM19035. J. Bacteriol. 187: 6094–6105.