Difference between revisions of "Part:BBa K1875017"

 
(4 intermediate revisions by the same user not shown)
Line 4: Line 4:
 
Double Operator
 
Double Operator
 
   
 
   
The BostonU 2016 iGEM team’s Gemini Library contains analog parts in addition to their digital partsThey synthesized multimerized binding sites to increase the expression of the operator. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to.  In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. The graph below demonstrates a screen with this multimerized operator containing the target for g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.
+
The [http://2016.igem.org/Team:BostonU 2016 BostonU] iGEM team designed a set of mutually orthogonal guide RNA (gRNA) expression vectors and gRNA operator reporters that could activate the expression of a gene of interest. This part contains a double multimerized gRNA operator target sequence for gRNA 13 from BostonU’s Gemini Library (Part [https://parts.igem.org/Part:BBa_K1875008 BBa_K1875008]). The introduction of the gRNA leads to a significant fold increase in expression of the gene of interest in a gRNA operator reporter with a single binding site in comparison to the basal level tested without the gRNATo further increase the expression of the operator, they synthesized gRNA operator reporters with multimerized binding sites as part of their “analog” library. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to.  In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. The graph below demonstrates a screen with this multimerized operator containing the target for gRNA 13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.
 +
 
 +
[[File:T--BostonU--2xpGOP_circle_map.png|400px|thumb|left|Figure 1: Double multimerized gRNA operator reporter plasmid map]]
 +
 
 +
[[File:T--BostonU--g13_multimerized.png|400px|thumb|center|Figure 2: Screen of GFP expression in double and triple multimerized operator reporters (containing g13) with and without the gRNA expression vector]]
 +
 
 +
 
 +
 
 +
 
 +
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Latest revision as of 00:53, 19 October 2016

This operator, when paired with a guide RNA, expresses GFP.

Double Operator

The [http://2016.igem.org/Team:BostonU 2016 BostonU] iGEM team designed a set of mutually orthogonal guide RNA (gRNA) expression vectors and gRNA operator reporters that could activate the expression of a gene of interest. This part contains a double multimerized gRNA operator target sequence for gRNA 13 from BostonU’s Gemini Library (Part BBa_K1875008). The introduction of the gRNA leads to a significant fold increase in expression of the gene of interest in a gRNA operator reporter with a single binding site in comparison to the basal level tested without the gRNA. To further increase the expression of the operator, they synthesized gRNA operator reporters with multimerized binding sites as part of their “analog” library. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to. In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. The graph below demonstrates a screen with this multimerized operator containing the target for gRNA 13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.

Figure 1: Double multimerized gRNA operator reporter plasmid map
Figure 2: Screen of GFP expression in double and triple multimerized operator reporters (containing g13) with and without the gRNA expression vector




Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 974
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]