Difference between revisions of "Part:BBa K1928004"

 
 
Line 3: Line 3:
 
<partinfo>BBa_K1928004 short</partinfo>
 
<partinfo>BBa_K1928004 short</partinfo>
  
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(TTCTTTTTGGTTTTCTTTGTGGTTGGCAGC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 2a RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 2a.
+
Toehold switch is a secondary structure of RNA.  
  
 
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
 +
Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(TTCTTTTTGGTTTTCTTTGTGGTTGGCAGC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 2a RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 2a.
 +
 +
===Characterization===
 +
 +
The validity of the toehold switch for the application of detection of HCV was performed using trigger RNA and firefly luciferase as reporter gene. [Figure 1]The glow indicates the expression of firefly luciferase, and thus validates that the hairpin of the toehold switch is unwound upon binding of a trigger RNA. This part is validated.
 +
 +
 +
 +
[[File:T--Shenzhen SFLS--validation1.png|center|500px|thumb|'''Figure 1''']]
 +
  
 
<!-- -->
 
<!-- -->

Latest revision as of 18:05, 19 October 2016


toehold switch sensor to detect HCV2a RNA

Toehold switch is a secondary structure of RNA.

Usage and Biology

Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(TTCTTTTTGGTTTTCTTTGTGGTTGGCAGC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 2a RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 2a.

Characterization

The validity of the toehold switch for the application of detection of HCV was performed using trigger RNA and firefly luciferase as reporter gene. [Figure 1]The glow indicates the expression of firefly luciferase, and thus validates that the hairpin of the toehold switch is unwound upon binding of a trigger RNA. This part is validated.


Figure 1


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]