Difference between revisions of "Part:BBa K2027031:Design"

 
 
(One intermediate revision by one other user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
TBA
+
This part was created using Gibson Assembly to clone the gene coding for the DNA2.0 chromoprotein into pSB1C3. We also added a FLAG, lumino and 6x histidine tag in order be able to extract the expressed protein using nickel column purification. The lumino tag is a specific six amino acid sequence that binds to the Lumio<sup>TM</sup> Green [1] which allows the fusion of the lumino tag and the chromoprotein to be detected on an SDS-Page Gel without having to run a staining protocol. The FLAG tag allows for anything after its sequence to be cleaved off of the protein when the extracted protein is incubated with enterokinase [2].This was done in case the lumino or histidine tag interfered with the chromoprotein structure. Additionally, a cellulose binding domain was added to each of the chromoproteins. This cellulose binding domain was from the BioBrick <partinfo>BBa_K1321366</partinfo> which also has a GFP fused to it. For the purposes of our experiments, we isolated the cellulose binding domain from this part using PCR. The cellulose binding domain sequence was isolated from <i>Cellulomonas fimi</i> and has been shown to bind irreversibly to cellulose [3].
  
 +
Verified Sequence: TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTTAGGAGGTAAACATATGGCAAGCTTGGTTAAGAAAGATATGTGTATTAAGATGACGATGGAGGGTACTGTGAACGGTCACCATTTCAAATGCGTCGGTGAGGGTGAAGGCAAACCGTTCGAAGGTACCCAGAACATGCGTATCCGCGTAACCGAAGGTGCGCCGCTGCCGTTTGCGTACGACATCCTGGCACCGTGCTGCATGTACGGCAGCAAGACGTTCATTAAGCACACCTCTGGCATTCCTGATTACTTCAAACAGAGCTTTCCGGAGGGCTTTACGTGGGAGCGTACCCAGATTTTTGAGGACGGTGGTTATTTGACCATTCACCAAGATACCTCCCTGCAAGGCAATAACTTTATCTTCAAAGTTAATGTTATCGGCGCGAATTTCCCGGCGAATGGCCCAGTGATGCAAAAGAAAACGGCGGGTTGGGAGCCGTGCGTGGAGATGCTGTACCCGCGTGATGGTGTCCTGTGTGGTCAGAGCCTGATGGCCCTGAAATGTACCGACGGTAACCACCTGACCAGCCATCTGCGTACTACCTACCGCAGCCGTAAGCCGAGCAACGCCGTCAACATGCCGGAGTTTCACTTCGGCGACCATCGCATCGAAATTCTGAAAGCTGAGCAAGGTAAATTCTATGAACAATATGAGAGCGCGGTGGCACGTTATTGCGAAGCGGCTCCGTCTAAGCTGGGTCATCACACCGGCGGTCCGGCCGGGTGCCAGGTGCTGTGGGGCGTCAACCAGTGGAACACCGGCTTCACCGCGAACGTCACCGTGAAGAACACGTCCTCCGCTCCGGTAGACGGCTGGACGCTCACGTTCAGCTTCCCGTCCGGCCAGCAGGTCACCCAGGCGTGGAGCTCGACGGTCACGCAGTCCGGCTCGGCCGTGACGGTCCGCAACGCCCCGTGGAACGGCTCGATCCCGGCGGGCGGCACCGCGCAGTTCGGCTTCAACGGCTCGCACACGGGCACCAACGCCGCGCCGACGGCGTTCTCGCTCAACGGCACGCCCTGCACGGTCGGCGGCAGCGACTACAAAGACGATGACGACAAGTGTTGTCCTGGCTGTTGCGGTGCTGGTGGCCATCATCACCATCACCAT
  
−
 
−
===Source===
 
−
 
−
TBA
 
  
 
===References===
 
===References===
 +
[1] "Lumio Green Detection Kit - Thermo Fisher Scientific."; N.p., n.d. Web. 2 Oct. 2016. <br>
 +
[2] "FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8." FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8. N.p., n.d. Web. 02 Oct. 2016. <br>
 +
[3] Carrard, G., A. Koivula, H. Soderlund, and P. Beguin. "Cellulose-binding Domains Promote Hydrolysis of Different Sites on Crystalline Cellulose." Proceedings of the National Academy of Sciences 97.19 (2000): 10342-0347. Web.

Latest revision as of 10:31, 25 October 2016


VirginiaViolet-Cellulose Binding Domain-Flag-Lumio-His-tag Fusion Protein


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 7
    Illegal NheI site found at 30
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 739


Design Notes

This part was created using Gibson Assembly to clone the gene coding for the DNA2.0 chromoprotein into pSB1C3. We also added a FLAG, lumino and 6x histidine tag in order be able to extract the expressed protein using nickel column purification. The lumino tag is a specific six amino acid sequence that binds to the LumioTM Green [1] which allows the fusion of the lumino tag and the chromoprotein to be detected on an SDS-Page Gel without having to run a staining protocol. The FLAG tag allows for anything after its sequence to be cleaved off of the protein when the extracted protein is incubated with enterokinase [2].This was done in case the lumino or histidine tag interfered with the chromoprotein structure. Additionally, a cellulose binding domain was added to each of the chromoproteins. This cellulose binding domain was from the BioBrick BBa_K1321366 which also has a GFP fused to it. For the purposes of our experiments, we isolated the cellulose binding domain from this part using PCR. The cellulose binding domain sequence was isolated from Cellulomonas fimi and has been shown to bind irreversibly to cellulose [3].

Verified Sequence: TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTTAGGAGGTAAACATATGGCAAGCTTGGTTAAGAAAGATATGTGTATTAAGATGACGATGGAGGGTACTGTGAACGGTCACCATTTCAAATGCGTCGGTGAGGGTGAAGGCAAACCGTTCGAAGGTACCCAGAACATGCGTATCCGCGTAACCGAAGGTGCGCCGCTGCCGTTTGCGTACGACATCCTGGCACCGTGCTGCATGTACGGCAGCAAGACGTTCATTAAGCACACCTCTGGCATTCCTGATTACTTCAAACAGAGCTTTCCGGAGGGCTTTACGTGGGAGCGTACCCAGATTTTTGAGGACGGTGGTTATTTGACCATTCACCAAGATACCTCCCTGCAAGGCAATAACTTTATCTTCAAAGTTAATGTTATCGGCGCGAATTTCCCGGCGAATGGCCCAGTGATGCAAAAGAAAACGGCGGGTTGGGAGCCGTGCGTGGAGATGCTGTACCCGCGTGATGGTGTCCTGTGTGGTCAGAGCCTGATGGCCCTGAAATGTACCGACGGTAACCACCTGACCAGCCATCTGCGTACTACCTACCGCAGCCGTAAGCCGAGCAACGCCGTCAACATGCCGGAGTTTCACTTCGGCGACCATCGCATCGAAATTCTGAAAGCTGAGCAAGGTAAATTCTATGAACAATATGAGAGCGCGGTGGCACGTTATTGCGAAGCGGCTCCGTCTAAGCTGGGTCATCACACCGGCGGTCCGGCCGGGTGCCAGGTGCTGTGGGGCGTCAACCAGTGGAACACCGGCTTCACCGCGAACGTCACCGTGAAGAACACGTCCTCCGCTCCGGTAGACGGCTGGACGCTCACGTTCAGCTTCCCGTCCGGCCAGCAGGTCACCCAGGCGTGGAGCTCGACGGTCACGCAGTCCGGCTCGGCCGTGACGGTCCGCAACGCCCCGTGGAACGGCTCGATCCCGGCGGGCGGCACCGCGCAGTTCGGCTTCAACGGCTCGCACACGGGCACCAACGCCGCGCCGACGGCGTTCTCGCTCAACGGCACGCCCTGCACGGTCGGCGGCAGCGACTACAAAGACGATGACGACAAGTGTTGTCCTGGCTGTTGCGGTGCTGGTGGCCATCATCACCATCACCAT


References

[1] "Lumio Green Detection Kit - Thermo Fisher Scientific."; N.p., n.d. Web. 2 Oct. 2016.
[2] "FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8." FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8. N.p., n.d. Web. 02 Oct. 2016.
[3] Carrard, G., A. Koivula, H. Soderlund, and P. Beguin. "Cellulose-binding Domains Promote Hydrolysis of Different Sites on Crystalline Cellulose." Proceedings of the National Academy of Sciences 97.19 (2000): 10342-0347. Web.