Difference between revisions of "Part:BBa K2027018:Design"
(One intermediate revision by one other user not shown) | |||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | This part was created using Gibson Assembly to clone the gene coding for the DNA2.0 chromoprotein into pSB1C3. We also added a FLAG, lumino and 6x histidine tag in order be able to extract the expressed protein using nickel column purification. The lumino tag is a specific six amino acid sequence that binds to the Lumio<sup>TM</sup> Green [1] which allows the fusion of the lumino tag and the chromoprotein to be detected on an SDS-Page Gel without having to run a staining protocol. The FLAG tag allows for anything after its sequence to be cleaved off of the protein when the extracted protein is incubated with enterokinase [2].This was done in case the lumino or histidine tag interfered with the chromoprotein structure. Below is our sequencing verification for this part as well as the gel ran on the colony PCR using the VF and VR iGEM primers gel showing the bands at the correct size (~1000 base pairs) (Ladder(left), donnerMagenta, virginiaViolet, scroogeOrange, leorOrange, dreidelTeal, vixenPurple, seraphinaPink, cupidPink, tinselPurple, prancerPurple, maccabeePurple, blitzenBlue). | |
+ | https://static.igem.org/mediawiki/parts/d/d9/T--Stanford-Brown--his-tag-gel.jpg | ||
+ | https://static.igem.org/mediawiki/parts/9/9c/T--Stanford-Brown--VP-his-tag.jpg | ||
− | + | Verified Sequence: TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTTAGGAGGTAAACATATGGCGAGCTTGGTTAAGAAAGATATGTGTATTAAGATGACGATGGAAGGTACTGTGAACGGTTATCACTTTAAGTGCGTTGGCGAGGGTGAAGGCAAGCCGTTCGAGGGCACGCAGAACACGCGCATTCGTGTCACCGAGGGCGGTCCGCTGCCTTTTGCATTCGACATCCTGGCCCCGTGCTGTATGTACGGCTCTAAGACCTTCATTAAACACGTGAGCGGTATCCCGGATTACTTTAAAGAGTCCTTTCCAGAGGGCTTCACTTGGGAACGTACCCAGATTTTTGAGGACGGTGGTGTTCTGACCGCGCACCAAGACACCAGCCTGGAAGGTAATTGCCTGATCTATAAAGTGAAGGTTCTGGGTACCAATTTCCCGGCGAATGGTCCGGTGATGCAAAAGAAAACCGCGGGTTGGGAGCCGTGCGTCGAGATGCTGTATCCGCGTGACGGCGTCTTGTGTGGTCAGAGCTTGATGGCGCTGAAGTGCACCGATGGCAATCATCTGACCAGCCACCTGCGCACGACGTATCGTAGCCGTAAACCGAGCAACGCCGTTAACATGCCGGAGTTCCATTTTGGTGACCATCGCATCGAAATCCTGAAAGCTGAGCGGGGCAAATTCTACGAACAATACGAATCGGCTGTCGCACGTTACAGCGATGTGCCGGAAAAAGCGACGGACTACAAAGACGATGACGACAAGTGTTGTCCTGGCTGTTGCGGTGCTGGTGGCCATCATCACCATCACCAT | |
− | |||
===References=== | ===References=== | ||
+ | [1] "Lumio Green Detection Kit - Thermo Fisher Scientific."; N.p., n.d. Web. 2 Oct. 2016. <br> | ||
+ | [2] "FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8." FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8. N.p., n.d. Web. 02 Oct. 2016. <br> |
Latest revision as of 10:02, 25 October 2016
VixenPurple-Flag-Lumio-His-tag Fusion Protein
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
This part was created using Gibson Assembly to clone the gene coding for the DNA2.0 chromoprotein into pSB1C3. We also added a FLAG, lumino and 6x histidine tag in order be able to extract the expressed protein using nickel column purification. The lumino tag is a specific six amino acid sequence that binds to the LumioTM Green [1] which allows the fusion of the lumino tag and the chromoprotein to be detected on an SDS-Page Gel without having to run a staining protocol. The FLAG tag allows for anything after its sequence to be cleaved off of the protein when the extracted protein is incubated with enterokinase [2].This was done in case the lumino or histidine tag interfered with the chromoprotein structure. Below is our sequencing verification for this part as well as the gel ran on the colony PCR using the VF and VR iGEM primers gel showing the bands at the correct size (~1000 base pairs) (Ladder(left), donnerMagenta, virginiaViolet, scroogeOrange, leorOrange, dreidelTeal, vixenPurple, seraphinaPink, cupidPink, tinselPurple, prancerPurple, maccabeePurple, blitzenBlue).
Verified Sequence: TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTACTAGAGTTAGGAGGTAAACATATGGCGAGCTTGGTTAAGAAAGATATGTGTATTAAGATGACGATGGAAGGTACTGTGAACGGTTATCACTTTAAGTGCGTTGGCGAGGGTGAAGGCAAGCCGTTCGAGGGCACGCAGAACACGCGCATTCGTGTCACCGAGGGCGGTCCGCTGCCTTTTGCATTCGACATCCTGGCCCCGTGCTGTATGTACGGCTCTAAGACCTTCATTAAACACGTGAGCGGTATCCCGGATTACTTTAAAGAGTCCTTTCCAGAGGGCTTCACTTGGGAACGTACCCAGATTTTTGAGGACGGTGGTGTTCTGACCGCGCACCAAGACACCAGCCTGGAAGGTAATTGCCTGATCTATAAAGTGAAGGTTCTGGGTACCAATTTCCCGGCGAATGGTCCGGTGATGCAAAAGAAAACCGCGGGTTGGGAGCCGTGCGTCGAGATGCTGTATCCGCGTGACGGCGTCTTGTGTGGTCAGAGCTTGATGGCGCTGAAGTGCACCGATGGCAATCATCTGACCAGCCACCTGCGCACGACGTATCGTAGCCGTAAACCGAGCAACGCCGTTAACATGCCGGAGTTCCATTTTGGTGACCATCGCATCGAAATCCTGAAAGCTGAGCGGGGCAAATTCTACGAACAATACGAATCGGCTGTCGCACGTTACAGCGATGTGCCGGAAAAAGCGACGGACTACAAAGACGATGACGACAAGTGTTGTCCTGGCTGTTGCGGTGCTGGTGGCCATCATCACCATCACCAT
References
[1] "Lumio Green Detection Kit - Thermo Fisher Scientific."; N.p., n.d. Web. 2 Oct. 2016.
[2] "FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8." FLAG Tag Peptide|Versatile Fusion Tag|CAS# 98849-88-8. N.p., n.d. Web. 02 Oct. 2016.