Difference between revisions of "Part:BBa K1645998:Experience"
(→Applications of BBa_K1645998) |
(→Applications of BBa_K1645998) |
||
(3 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter | This experience page is provided so that any user may enter their experience using this part.<BR>Please enter | ||
how you used this part and how it worked out. | how you used this part and how it worked out. | ||
+ | |||
+ | <html> | ||
+ | <figure style="width:60%; margin: 0 auto;"> | ||
+ | <img src="/wiki/images/d/de/BBa_B1645998-experience.png" width="400"> | ||
+ | </figure> | ||
+ | </html> | ||
===Applications of BBa_K1645998=== | ===Applications of BBa_K1645998=== | ||
− | This part can be used along with Cas9 | + | This part can be used along with CRISPR Cas9 system guiding cas9 protein to the target sequence. For our purposes we used dCas9 and we used RFP that is under lacI promoter. Then RFP intensity was measured using Imaging Flow Cytometry (amnis). Since dCas9 is mutated and has no nuclease activity it will be placed on the promoter region and block the RNA polymerase from binding. This part was placed in front of a U6 promoter in order to suppress transcription of a RFP. |
− | Our experiment was conducted in BL21. The characterization data using this part | + | Our experiment was conducted in BL21 and IPTG was used to induce both RFP expression and dCas9 expression. The dcas9 used in our purposes was obtained from addgene plasmid #60815. The characterization data using this part demonstrates that when using this sgRNA co-transformed with dCas9, the RFP intensity which uses the LacI promoter is being suppressed by 41% compared with our control RFP not containing dCas9. Here is the Flow Cytometry results, where the grey is control and purple is this biobrick used with dCas9 targeting RFP. This graph shows data from three separate experiments, the mean intensity values of RFP for all three trials are provided below: |
+ | Trial(1):RFP-Only (IPTG) 14521.69, sgRNA-RFP-dCas9 (IPTG) 7148.96 | ||
+ | Trial(2):RFP-Only (IPTG) 23135.77, sgRNA-RFP-dCas9 (IPTG) 5520.53 | ||
+ | Trial(3):RFP-Only (IPTG) 11750.96, sgRNA-RFP-dCas9 (IPTG) 7413.74 | ||
+ | |||
+ | Sequence for U6 promoter: | ||
+ | gcagatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgacgctactagaattcgagctcggagtgatcaaaagtcccacatcgatcaggtgatatatagcagcttagtttatataatgatagagtcgacatagcgattg | ||
===User Reviews=== | ===User Reviews=== |
Latest revision as of 15:21, 26 September 2015
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K1645998
This part can be used along with CRISPR Cas9 system guiding cas9 protein to the target sequence. For our purposes we used dCas9 and we used RFP that is under lacI promoter. Then RFP intensity was measured using Imaging Flow Cytometry (amnis). Since dCas9 is mutated and has no nuclease activity it will be placed on the promoter region and block the RNA polymerase from binding. This part was placed in front of a U6 promoter in order to suppress transcription of a RFP. Our experiment was conducted in BL21 and IPTG was used to induce both RFP expression and dCas9 expression. The dcas9 used in our purposes was obtained from addgene plasmid #60815. The characterization data using this part demonstrates that when using this sgRNA co-transformed with dCas9, the RFP intensity which uses the LacI promoter is being suppressed by 41% compared with our control RFP not containing dCas9. Here is the Flow Cytometry results, where the grey is control and purple is this biobrick used with dCas9 targeting RFP. This graph shows data from three separate experiments, the mean intensity values of RFP for all three trials are provided below: Trial(1):RFP-Only (IPTG) 14521.69, sgRNA-RFP-dCas9 (IPTG) 7148.96 Trial(2):RFP-Only (IPTG) 23135.77, sgRNA-RFP-dCas9 (IPTG) 5520.53 Trial(3):RFP-Only (IPTG) 11750.96, sgRNA-RFP-dCas9 (IPTG) 7413.74
Sequence for U6 promoter: gcagatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgacgctactagaattcgagctcggagtgatcaaaagtcccacatcgatcaggtgatatatagcagcttagtttatataatgatagagtcgacatagcgattg
User Reviews
UNIQ0114b1af0df0b8d6-partinfo-00000001-QINU UNIQ0114b1af0df0b8d6-partinfo-00000002-QINU