Difference between revisions of "Part:BBa K1679005"

 
(8 intermediate revisions by the same user not shown)
Line 3: Line 3:
  
 
This is a device that contain promoter BBa_J23117, RiboJ and BBa_I13504.
 
This is a device that contain promoter BBa_J23117, RiboJ and BBa_I13504.
 +
 +
===Overview===
 +
                <p>
 +
                    Promoter parts are often defined by a relatively short (~50 bp) sequence, but regions 100 bp or more upstream can affect promoter strength, and the effect of remote sequences can be reduced by including an insulator region.Ribo J is a kind of ribozyme-based insulator part that can buffer synthetic circuits from genetic context. It is a useful tool for measuring the strength of promoters which can make the disruption from genetic context to be reduced.<BR>As a matter of fact, our results from plate reader and flow cytometer show that the expression of GFP under J23117 promoter have a little difference with or without Ribo J. It proved that the Ribo J did has the function of buffering.
 +
<h3>Attention Please!</h3>
 +
The right sequence should be "ttgacagctagctcagtcctagggattgtgctagctactagagagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata".
 +
But the DNA Sample we submit is correct.
 +
We are so sorry for this problem.
 +
                </p>
  
 
===Plate Reader Result===
 
===Plate Reader Result===
Line 28: Line 37:
 
                 <p>
 
                 <p>
 
                     All samples were cut the mean of background value, and then compared with the calibration curve to get the final dataset in units of fluorescein.
 
                     All samples were cut the mean of background value, and then compared with the calibration curve to get the final dataset in units of fluorescein.
 +
                </p>
 +
               
 +
                <p></p>
 
                 <div style="width: 80%;margin: 0 auto;">
 
                 <div style="width: 80%;margin: 0 auto;">
 
                     <center>https://static.igem.org/mediawiki/2015/c/c5/OUC-China-InterLab_4.jpg</center>
 
                     <center>https://static.igem.org/mediawiki/2015/c/c5/OUC-China-InterLab_4.jpg</center>
Line 37: Line 49:
 
                 </div>
 
                 </div>
 
                 <p></p>
 
                 <p></p>
 +
 +
===Flow Cytometer Result===
 +
                <p></p>
 +
                <h3>Equipment</h3>
 +
                <p>Epics-XL<BR>Beckman Coulter</p>
 +
                <h3>Protocol</h3>
 +
                <p>
 +
                    Date: 2015 Aug 12<BR>1. Start up the instrument and warm up it until it shows “Awaiting Sample”<BR>2. Calibrate the instrument with check beads<BR>3. Mix the fluorescent beads and negative sample (E coli. without plasmid) and dilute it to 1 mL<BR>4. Measure the mix and regulate voltage until the points appear in the appropriate location and set gates<BR></p>
 +
              <div style="width: 60%;margin: 0 auto;">
 +
                    <center>https://static.igem.org/mediawiki/2015/d/df/OUC-China-InterLab_9.png</center>
 +
                </div>
 +
                <div style="width: 60%;margin: 0 auto;">
 +
                    <center>https://static.igem.org/mediawiki/2015/2/28/OUC-China-InterLab_10.jpg</center>
 +
                </div>
 +
<p>5. Measure the other samples in three biological replicates and three technical replicates<BR>6. Use the Cleanase and ddH2O to clean the instrument as instruction<BR>7. Process the data
 +
                </p>
 +
                <h3>Unit</h3>
 +
                <p>
 +
                    The fluorescence of GFPwas compared with the 2.00μm Fluoresbrite Yellow Green (YG) Microspheres.
 +
                </p>
 +
                <h3>Dataset</h3>
 +
                <div style="width: 100%;margin: 0 auto;">
 +
                    <center>https://static.igem.org/mediawiki/2015/f/fb/OUC-China-InterLab_11.png</center>
 +
                </div>
 +
 +
  
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K1679005 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1679005 SequenceAndFeatures</partinfo>
 
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 10:40, 10 October 2016

GFP Reporter

This is a device that contain promoter BBa_J23117, RiboJ and BBa_I13504.

Overview

Promoter parts are often defined by a relatively short (~50 bp) sequence, but regions 100 bp or more upstream can affect promoter strength, and the effect of remote sequences can be reduced by including an insulator region.Ribo J is a kind of ribozyme-based insulator part that can buffer synthetic circuits from genetic context. It is a useful tool for measuring the strength of promoters which can make the disruption from genetic context to be reduced.
As a matter of fact, our results from plate reader and flow cytometer show that the expression of GFP under J23117 promoter have a little difference with or without Ribo J. It proved that the Ribo J did has the function of buffering.

Attention Please!

The right sequence should be "ttgacagctagctcagtcctagggattgtgctagctactagagagctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata". But the DNA Sample we submit is correct. We are so sorry for this problem.

Plate Reader Result

Equipment

Varioskan Flash Multimode Reader
Thermo Scientific
Read Speed: 6.4 well per second

Software

Run Software Version: Skanlt Software 2.4.5 RE for Varioskan Flash
Current Software Version: Skanlt Software 2.4.5 RE for Varioskan Flash

Protocol

Date: 2015 Aug 12
1. Set our instrument to read OD600
2. Setup a 96-well plate with our cultures
3. Take the measurement and record it
4. Calculate the dilution required for each sample (OD600=0.5)
5. Dilute each sample
6. Remeasure our sample on OD600
7. Recalculate our dilution and remeasure until it's within 5% of 0.5.

Unit

Three technical replicates of M9 liquid media was measured, which were called background value.
A series of concentration of sodium fluorescein was measured, which are 0, 10, 20, 40, 80, 160, 320, 640 ng/mL . A calibration curve was defined.

OUC-China-InterLab_2.jpg

Dataset

All samples were cut the mean of background value, and then compared with the calibration curve to get the final dataset in units of fluorescein.

OUC-China-InterLab_4.jpg

TR: Technical Replicate
BR: Biological Replicate

OUC-China-InterLab_5.png

Flow Cytometer Result

Equipment

Epics-XL
Beckman Coulter

Protocol

Date: 2015 Aug 12
1. Start up the instrument and warm up it until it shows “Awaiting Sample”
2. Calibrate the instrument with check beads
3. Mix the fluorescent beads and negative sample (E coli. without plasmid) and dilute it to 1 mL
4. Measure the mix and regulate voltage until the points appear in the appropriate location and set gates

OUC-China-InterLab_9.png
OUC-China-InterLab_10.jpg

5. Measure the other samples in three biological replicates and three technical replicates
6. Use the Cleanase and ddH2O to clean the instrument as instruction
7. Process the data

Unit

The fluorescence of GFPwas compared with the 2.00μm Fluoresbrite Yellow Green (YG) Microspheres.

Dataset

OUC-China-InterLab_11.png


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 7
    Illegal NheI site found at 30
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 788