Difference between revisions of "Part:BBa K1728000"

(Toehold switch secondary structure prediction)
 
(9 intermediate revisions by 2 users not shown)
Line 3: Line 3:
  
 
IL8 toehold switch RNA sensor
 
IL8 toehold switch RNA sensor
    Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site(RBS)in the loop. There  are three basic elements of toehold switches including 30bp trigger sequence, bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of oral cancer biomarker IL8(Interleukin 8) mRNA. Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.<br>
 
  
<!-- Add more about the biology of this part here
+
 
 
===Usage and Biology===
 
===Usage and Biology===
    Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site(RBS)in the loop. There  are three basic elements of toehold switches including 30bp trigger sequence, bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of oral cancer biomarker IL8(Interleukin 8) mRNA. Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.
 
  
 +
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There  are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.
 +
 +
== Toehold switch secondary structure prediction ==
 +
 +
https://static.igem.org/mediawiki/2015/1/1e/CGU_IL8.jpeg
  
 
<!-- -->
 
<!-- -->

Latest revision as of 02:30, 19 September 2015

IL8 toehold switch RNA sensor

IL8 toehold switch RNA sensor


Usage and Biology

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.

Toehold switch secondary structure prediction

CGU_IL8.jpeg

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]