Difference between revisions of "Part:BBa K1807000:Experience"
(→Applications of BBa_K1807000) |
|||
| (3 intermediate revisions by the same user not shown) | |||
| Line 14: | Line 14: | ||
We have sequenced single three colonies (clones) from the plate. | We have sequenced single three colonies (clones) from the plate. | ||
| − | + | == Applications of BBa_K1807000 == | |
| − | == | + | |
iGEM York 2015 used this part as an expression vector and assembled multiple IPTG-inducible protein generators. This part collection was assembled with colony PCR products that were gel extracted and with synthesized dsDNA fragments (G Blocks). | iGEM York 2015 used this part as an expression vector and assembled multiple IPTG-inducible protein generators. This part collection was assembled with colony PCR products that were gel extracted and with synthesized dsDNA fragments (G Blocks). | ||
| + | |||
| + | iGEM York used a Colony PCR Screening technique to identify positive transformants and insert size. | ||
| + | |||
| + | Forward Colony PCR Primer: GCACATACGAGAAAGAGGAGAAATACCCC | ||
| + | |||
| + | Reverse Colony PCR Primer: GCCTTTCGTTTTATTTGATGCCTGGC | ||
| + | |||
| + | == User Reviews == | ||
Latest revision as of 18:26, 18 September 2015
Above is a photograph of the BBa_K1807000 Gibson Assembly Reaction transformation. Escherichia coli NEB 5 alpha cells were spread onto LB Agar Plates containing Chloramphenicol 34ng/mL, IPTG ng/mL, Xgal ng/mL.
For the Gibson Assembly Reaction we mixed 100ng of PCR-linearized (provided with the distribution) and EcoRI-digested pSB1C3 vector backbone together with 3 times the molar ratio of our Adapter BioBrick G Block dsDNA. We incubated the reaction at 50 degrees Celsius for an hour and then used 2uL (out of 20uL total) in a standard heat-shock transformation of chemically competent cells.
Result: We did not observe white colonies on the plate - thus we estimated the Gibson Assembly efficiency for this reaction to be 100%.
We have sequenced single three colonies (clones) from the plate.
Applications of BBa_K1807000
iGEM York 2015 used this part as an expression vector and assembled multiple IPTG-inducible protein generators. This part collection was assembled with colony PCR products that were gel extracted and with synthesized dsDNA fragments (G Blocks).
iGEM York used a Colony PCR Screening technique to identify positive transformants and insert size.
Forward Colony PCR Primer: GCACATACGAGAAAGAGGAGAAATACCCC
Reverse Colony PCR Primer: GCCTTTCGTTTTATTTGATGCCTGGC