Difference between revisions of "Part:BBa K515100:Experience"
Qiuxinyuan12 (Talk | contribs) |
Qiuxinyuan12 (Talk | contribs) |
||
Line 33: | Line 33: | ||
This part is the only one available with IAAM and IAAH , but unfortunately, we noticed that neither of the CDS of those two enzyme were submitted to the registry (they were only registered as BBa_K515000 and K515001). Thus, several improvements were made based on the part K515100 to provide an available version of IAAM and IAAH. | This part is the only one available with IAAM and IAAH , but unfortunately, we noticed that neither of the CDS of those two enzyme were submitted to the registry (they were only registered as BBa_K515000 and K515001). Thus, several improvements were made based on the part K515100 to provide an available version of IAAM and IAAH. | ||
− | =Two pairs of enzymes that can PCR-prep the CDS of IaaM and IaaH= | + | ====Two pairs of enzymes that can PCR-prep the CDS of IaaM and IaaH==== |
For IAAM | For IAAM | ||
Line 48: | Line 48: | ||
R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’ | R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’ | ||
− | =Two new bio-bricks were designed based on this part using the primers above= | + | ====Two new bio-bricks were designed based on this part using the primers above==== |
See BBa_K1789000 and BBa_K1789001 | See BBa_K1789000 and BBa_K1789001 | ||
Both of those parts were sent to the registry. | Both of those parts were sent to the registry. | ||
− | |||
|}; | |}; | ||
<!-- DON'T DELETE --><partinfo>BBa_K515100 EndReviews</partinfo> | <!-- DON'T DELETE --><partinfo>BBa_K515100 EndReviews</partinfo> |
Latest revision as of 16:27, 18 September 2015
Applications of BBa_K515100
- The enzymatic reactions of the IAM pathway produce indole-3 acetic acid (IAA) which is an important phytohormone.
- Many Plant Growth Promoting Rhizobacteria produce IAA
- Analogues of phytohormones like α-Naphthaleneacetic acid are usually found in rooting powders. Therefore, if we were to express IAA in bacteria in a controlled fashion we could increase root growth.
- Increased root growth could help maintain top soil.
- Evidence has shown that using IAA on cotton can increase yields.
User Reviews
UNIQ51fab7aae39c6164-partinfo-00000001-QINU
•••••
NUDT_CHINA 2015 |
This part is the only one available with IAAM and IAAH , but unfortunately, we noticed that neither of the CDS of those two enzyme were submitted to the registry (they were only registered as BBa_K515000 and K515001). Thus, several improvements were made based on the part K515100 to provide an available version of IAAM and IAAH. Two pairs of enzymes that can PCR-prep the CDS of IaaM and IaaHFor IAAM F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGTTTGGACCGG-3’ R-Prime: 5’- GCGGCGGACTAGTCTTATTAGTCCCCCAGCG -3’
F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGCGCGAAATG -3’ R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’ Two new bio-bricks were designed based on this part using the primers aboveSee BBa_K1789000 and BBa_K1789001 Both of those parts were sent to the registry. |
UNIQ51fab7aae39c6164-partinfo-00000003-QINU