Difference between revisions of "Part:BBa K1758310:Design"
(Created page with "__NOTOC__ <partinfo>BBa_K1758310 short</partinfo> <partinfo>BBa_K1758310 SequenceAndFeatures</partinfo> ===Design Notes=== ===Source=== <html> <P> Thesource original sourc...") |
|||
(3 intermediate revisions by 2 users not shown) | |||
Line 6: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
+ | <html> | ||
+ | We used the codon optimized, synthesized Sequence of chrB from iGEM Team BIT 2013(<a href="https://parts.igem.org/wiki/index.php?title=Part:BBa_K346001 " target="_blank"> BBa_K346001 </a>) under the control of a constitutive Primer(<a href="https://parts.igem.org/wiki/index.php?title=Part:BBa_K608002" target="_blank">BBa_608002</a>). We designed the used primes, in specially split primers, for Gibson Assembly to ligate the constitutive Promoter and <i>chrB</i> with pSB1C3. For this aim we designed four primers for the generation of homologous overlaps between the synthesized <i>chrB</i> under contol of constitutive promoter and the pSB1C3: | ||
+ | <p> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_fwd" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_fwd" target="_blank">cm_fwd</a> (CGGCATCAGCACCTTGTC)</p> | ||
+ | |||
+ | <p> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#pSB1C3_chrB_rev" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#pSB1C3_chrB_rev" target="_blank">pSB1C3_chrB_rev</a> (CTTTTGAAAAAGGCACTCTGACCGTTTGACTCTAGAAGCGGCCGCGAAT)</p> | ||
+ | |||
+ | <p><a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_rev" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers#cm_rev" target="_blank">cm_rev</a> (TATACGCAAGGCGACAAG) </p> | ||
+ | |||
+ | <p><a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers# pSB1C3_kPrm_fwd" target="_blank"> <a href="http://2015.igem.org/Team:Bielefeld-CeBiTec/Primers# pSB1C3_kPrm_fwd" target="_blank"> pSB1C3_kPrm_fwd</a> (CTAGGACTGAGCTAGCTGTCAATACTAGTAGCGGCCGCTGCA)</p> | ||
+ | |||
+ | </html> | ||
===Source=== | ===Source=== | ||
<html> | <html> | ||
− | <P> | + | <P> The original source of our chromate repressor is <i>Ochrobactrum tritici</i> 5bvl1. We used a codon optimized version which we got synthesised by IDT. |
</html> | </html> | ||
===References=== | ===References=== |
Latest revision as of 02:47, 19 September 2015
Chromium repressor under control of constitutive promoter and strong RBS
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 55
Illegal NheI site found at 966
Illegal NheI site found at 989 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 124
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
We used the codon optimized, synthesized Sequence of chrB from iGEM Team BIT 2013( BBa_K346001 ) under the control of a constitutive Primer(BBa_608002). We designed the used primes, in specially split primers, for Gibson Assembly to ligate the constitutive Promoter and chrB with pSB1C3. For this aim we designed four primers for the generation of homologous overlaps between the synthesized chrB under contol of constitutive promoter and the pSB1C3:
cm_fwd (CGGCATCAGCACCTTGTC)
pSB1C3_chrB_rev (CTTTTGAAAAAGGCACTCTGACCGTTTGACTCTAGAAGCGGCCGCGAAT)
cm_rev (TATACGCAAGGCGACAAG)
pSB1C3_kPrm_fwd (CTAGGACTGAGCTAGCTGTCAATACTAGTAGCGGCCGCTGCA)
Source
The original source of our chromate repressor is Ochrobactrum tritici 5bvl1. We used a codon optimized version which we got synthesised by IDT.