Difference between revisions of "Part:BBa K1807000:Experience"
(→‎Applications of BBa_K1807000)
 
(7 intermediate revisions by the same user not shown)
Line 6: Line 6:
  
 
Above is a photograph of the BBa_K1807000 Gibson Assembly Reaction transformation.
 
Above is a photograph of the BBa_K1807000 Gibson Assembly Reaction transformation.
 +
Escherichia coli NEB 5 alpha cells were spread onto LB Agar Plates containing Chloramphenicol 34ng/mL, IPTG ng/mL, Xgal ng/mL.
 +
 +
For the Gibson Assembly Reaction we mixed 100ng of PCR-linearized (provided with the distribution) and EcoRI-digested pSB1C3 vector backbone together with 3 times the molar ratio of our Adapter BioBrick G Block dsDNA. We incubated the reaction at 50 degrees Celsius for an hour and then used 2uL (out of 20uL total) in a standard heat-shock transformation of chemically competent cells.
 +
 +
'''Result:''' We did not observe white colonies on the plate - thus we estimated the Gibson Assembly efficiency for this reaction to be 100%.
 +
 +
We have sequenced single three colonies (clones) from the plate.
 +
 +
== Applications of BBa_K1807000 ==
 +
 +
iGEM York 2015 used this part as an expression vector and assembled multiple IPTG-inducible protein generators. This part collection was assembled with colony PCR products that were gel extracted and with synthesized dsDNA fragments (G Blocks).
 +
 +
iGEM York used a Colony PCR Screening technique to identify positive transformants and insert size.
 +
 +
Forward Colony PCR Primer: GCACATACGAGAAAGAGGAGAAATACCCC
 +
 +
Reverse Colony PCR Primer: GCCTTTCGTTTTATTTGATGCCTGGC
 +
 +
== User Reviews ==

Latest revision as of 18:26, 18 September 2015

Above is a photograph of the BBa_K1807000 Gibson Assembly Reaction transformation. Escherichia coli NEB 5 alpha cells were spread onto LB Agar Plates containing Chloramphenicol 34ng/mL, IPTG ng/mL, Xgal ng/mL.

For the Gibson Assembly Reaction we mixed 100ng of PCR-linearized (provided with the distribution) and EcoRI-digested pSB1C3 vector backbone together with 3 times the molar ratio of our Adapter BioBrick G Block dsDNA. We incubated the reaction at 50 degrees Celsius for an hour and then used 2uL (out of 20uL total) in a standard heat-shock transformation of chemically competent cells.

Result: We did not observe white colonies on the plate - thus we estimated the Gibson Assembly efficiency for this reaction to be 100%.

We have sequenced single three colonies (clones) from the plate.

Applications of BBa_K1807000

iGEM York 2015 used this part as an expression vector and assembled multiple IPTG-inducible protein generators. This part collection was assembled with colony PCR products that were gel extracted and with synthesized dsDNA fragments (G Blocks).

iGEM York used a Colony PCR Screening technique to identify positive transformants and insert size.

Forward Colony PCR Primer: GCACATACGAGAAAGAGGAGAAATACCCC

Reverse Colony PCR Primer: GCCTTTCGTTTTATTTGATGCCTGGC

User Reviews