Difference between revisions of "Part:BBa K1679038"

 
 
Line 4: Line 4:
  
 
After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme and an additional 23-nt hairpin immediately downstream to help expose the RBS. STRSV can cleaves the mRNA  autocatalytically at a defined residue, which had the effect of cleaving extraneous RNA leaders that arose from transcription from promoters with different start sites.[1] Attributed to the biochemical function mentioned above, RiboJ has insulating capability. We use it to buffer synthetic circuits from genetic context.  
 
After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme and an additional 23-nt hairpin immediately downstream to help expose the RBS. STRSV can cleaves the mRNA  autocatalytically at a defined residue, which had the effect of cleaving extraneous RNA leaders that arose from transcription from promoters with different start sites.[1] Attributed to the biochemical function mentioned above, RiboJ has insulating capability. We use it to buffer synthetic circuits from genetic context.  
 +
<h3>Attention Please!</h3>
 +
The right sequence should be "agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa".
 +
But the DNA Sample we submit is correct.
 +
We are so sorry for this problem.
  
 
[1] Lou C, Stanton B, Chen Y J, et al. Ribozyme-based insulator parts buffer synthetic circuits from genetic context[J]. Nature biotechnology, 2012, 30(11): 1137-1142.
 
[1] Lou C, Stanton B, Chen Y J, et al. Ribozyme-based insulator parts buffer synthetic circuits from genetic context[J]. Nature biotechnology, 2012, 30(11): 1137-1142.

Latest revision as of 10:44, 10 October 2016


RiboJ

After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme and an additional 23-nt hairpin immediately downstream to help expose the RBS. STRSV can cleaves the mRNA autocatalytically at a defined residue, which had the effect of cleaving extraneous RNA leaders that arose from transcription from promoters with different start sites.[1] Attributed to the biochemical function mentioned above, RiboJ has insulating capability. We use it to buffer synthetic circuits from genetic context.

Attention Please!

The right sequence should be "agctgtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaacagcctctacaaataattttgtttaa". But the DNA Sample we submit is correct. We are so sorry for this problem.

[1] Lou C, Stanton B, Chen Y J, et al. Ribozyme-based insulator parts buffer synthetic circuits from genetic context[J]. Nature biotechnology, 2012, 30(11): 1137-1142.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]