Difference between revisions of "Part:BBa K1795002"

 
 
(5 intermediate revisions by one other user not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
<partinfo>BBa_K1795001 short</partinfo>
+
<partinfo>BBa_K1795002 short</partinfo>
  
 
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence  atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.  
 
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence  atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.  
 +
 +
When co-transformed with RFP and BBa_K1795001 97% reduction of RFP was observed.
 +
[https://static.igem.org/mediawiki/2015/1/1b/WMgRNACompare.png]
 +
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 10: Line 13:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
<partinfo>BBa_K1795001 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K1795002 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
<partinfo>BBa_K1795001 parameters</partinfo>
+
<partinfo>BBa_K1795002 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 19:53, 18 September 2015

R0010 gRNA under R0040

This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.

When co-transformed with RFP and BBa_K1795001 97% reduction of RFP was observed. [1]


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]